I am attempting to create a loop that creates a file named "/tmp/newfile.txt" and creates 29 lines of text. Line 1 should read: "I see 0 sheep". For each line, 1 sheep should be added and a new line created to reflect that until 29 sheep (and lines) are reached.
x = 0
myDoc = myDoc.readfiles("/tmp/newfile.txt", "r+")
myDoc.write("I see" + str(x) + "sheep")
for line in myDoc.readfiles():
x = x + 1
myDoc.append(x)
print(myDoc)
if x == 30
break;
First, what I tried to do is create a new file and put it into a variable (myDoc) that would open it. I specified w+ so that I would have the ability to read the file and write on it. I gave the changing number a variable 'x'.
The function I intended to, for each line in the file, write "I see x sheep". Afterward, add 1 to the current value of x and append it so it's added to the file. After this, print it so I can see the line(s). Once that value reached 30, cease the loop because 29 is the number of lines I need.
My errors have to do with indentation and nothing being printed at all. I am extremely new to this.
Welcome to StackOverflow!
There seem to be a couple of issues in the code:
Indentation / Syntax Errors - It seems that you are using Python, which follows strict indentation and whitespace rules. An indent is inserted when you enter a new local scope / new control flow / enter an if/elif/else statement or a while or for loop, to separate it from the current scope.
You'd need to remove the space on the left side on line 3 and line 6.
Also, on line 8 there should be a colon(:) after the if x==30.
The mode used (w+) isn't going to work as expected.
This mode overwrites a file if it already exists and allows you to read and write to that file. Instead, you would need the r+ mode.
There's a great explanation & flowchart in this answer explaining the various file modes - https://stackoverflow.com/a/30566011/13307211
The for loop can't iterate over myDoc.
The open function gives a file object (TextIOWrapper), which can't be iterated over. You could use the myDoc.readfiles() method, which returns a list of lines present in the file and loop over that - for line in myDoc.readfiles().
printing myDoc and using .append() with myDoc wouldn't work as expected. It's representing a file object, which doesn't have an append method. Also, I feel like there might have been some mixed logic here - were you trying to iterate over myDoc like an array and hence pushing value to it?
I'd suggest removing the append part as the past value of x isn't going to be needed for what you want to do.
After applying the above, you should end up with code that looks like this -
x = 0
myDoc = open("./newfile.txt", "r+")
for line in myDoc.readlines():
myDoc.write("I see" + str(x) + "sheep\n")
x = x + 1
if x == 30:
break
Now, this doesn't exactly do what you want it to do...
The first thing we should do is update the for loop - a for loop should be structured in a way where it has a start, an end, and an increment, or it should iterate over a range of values. Python has a neat range function that allows you to iterate between values.
for x in range(1, 10):
print(x)
the above would print values from 1 to 10, excluding 10.
updating our for loop, we can change the code to -
myDoc = open("./newfile.txt", "r+")
for x in range(1, 30):
myDoc.write("I see" + str(x) + "sheep")
we could also use a while loop here -
myDoc = open("./newfile.txt", "r+")
for x in range(1, 30):
myDoc.write("I see" + str(x) + "sheep")
this makes the file but without the lines and without the right formatting. "I see " + str(x) + " sheep" should fix the sentence, but to print the string on multiple lines instead of the same line, you would need to use the newline character(\n) and add it at the end of the string -
myDoc = open("./newfile.txt", "r+")
for x in range(1, 30):
myDoc.write("I see" + str(x) + "sheep\n")
Related
I have been writing a program to get all the coordinates within a ten mile radius of any given point and when the distance data is printed its output is different from the data in the file. Not only this but it creates a blank line at the end of the file. What should I do?
import geopy.distance
distance_data = open("Distance from start.txt", "w")
distance_data.truncate()
distance_data_to_add = []
for i in range (360):
bearing = i
lat = 51.8983
long = 177.1822667
for i in range (10):
distance = i
new_lat_long =
geopy.distance.distance(miles=distance).destination((lat, long), bearing=bearing)
distance_data_to_add.append(new_lat_long)
for element in distance_data_to_add:
distance_data.write(str(element) + "\n")
print(distance_data_to_add)
An example line from the file is:
51 56m 30.0669s N, 177 10m 51.749s E
An example of the printed info in the console is:
Point(51.94168524994642, 177.1810413957121, 0.0)
The reason the objects look different in a list is because that is the repr version of them, not the str version. So write repr(element) to the file instead of str(element).
The reason there is a newline at the end of the file is because you write \n after every element.
Replace this:
for element in distance_data_to_add:
distance_data.write(str(element) + "\n")
with this:
distance_data.write('\n'.join(map(repr, distance_to_add)))
That will write the repr of each object, with a newline between each one (but not at the end).
And don't forget distance_data.close() after you finish writing your file.
I need this program to create a sheet as a list of strings of ' ' chars and distribute text strings (from a list) into it. I have already coded return statements in python 3 but this one keeps giving
return(riplns)
^
SyntaxError: invalid syntax
It's the return(riplns) on line 39. I want the function to create a number of random numbers (randint) inside a range built around another randint, coming from the function ripimg() that calls this one.
I see clearly where the program declares the list I want this return() to give me. I know its type. I see where I feed variables (of the int type) to it, through .append(). I know from internet research that SyntaxErrors on python's return() functions usually come from mistype but it doesn't seem the case.
#loads the asciified image ("/home/userX/Documents/Programmazione/Python projects/imgascii/myascify/ascimg4")
#creates a sheet "foglio1", same number of lines as the asciified image, and distributes text on it on a randomised line
#create the sheet foglio1
def create():
ref = open("/home/userX/Documents/Programmazione/Python projects/imgascii/myascify/ascimg4")
charcount = ""
field = []
for line in ref:
for c in line:
if c != '\n':
charcount += ' '
if c == '\n':
charcount += '*' #<--- YOU GONNA NEED TO MAKE THIS A SPACE IN A FOLLOWING FUNCTION IN THE WRITER.PY PROGRAM
for i in range(50):#<------- VALUE ADJUSTMENT FROM WRITER.PY GOES HERE(default : 50):
charcount += ' '
charcount += '\n'
break
for line in ref:
field.append(charcount)
return(field)
#turn text in a list of lines and trasforms the lines in a list of strings
def poemln():
txt = open("/home/gcg/Documents/Programmazione/Python projects/imgascii/writer/poem")
arrays = []
for line in txt:
arrays.append(line)
txt.close()
return(arrays)
#rander is to be called in ripimg()
def rander(rando, fldepth):
riplns = []
for i in range(fldepth):
riplns.append(randint((rando)-1,(rando)+1)
return(riplns) #<---- THIS RETURN GIVES SyntaxError upon execution
#opens a rip on the side of the image.
def ripimg():
upmost = randint(160, 168)
positions = []
fldepth = 52 #<-----value is manually input as in DISTRIB function.
positions = rander(upmost,fldepth)
return(positions)
I omitted the rest of the program, I believe these functions are enough to get the idea, please tell me if I need to add more.
You have incomplete set of previous line's parenthesis .
In this line:-
riplns.append(randint((rando)-1,(rando)+1)
You have to add one more brace at the end. This was causing error because python was reading things continuously and thought return statement to be a part of previous uncompleted line.
I am trying to write a python script,
which breaks a continuous string into lines,
when the max_line_length has been exceeded.
It shall not break words,
and searches therefore the last occurrence of a whitespace-char,
which will be replaced by a newline-char.
For some reason it does not break within the specified limit.
E.g. when defining the max_line_length = 80,
the text sometimes breaks at 82 or 83, etc.
Since quite some time I am trying to fix the problem,
however it feels like i am having the tunnel vision
and don't see the problem here:
#!/usr/bin/python
import sys
if len(sys.argv) < 3:
print('usage: $ python3 breaktext.py <max_line_length> <file>')
print('example: $ python3 breaktext.py 80 infile.txt')
exit()
filename = str(sys.argv[2])
with open(filename, 'r') as file:
text_str = file.read().replace('\n', '')
m = int(sys.argv[1]) # max_line_length
text_list = list(text_str) # convert string to list
l = 0; # line_number
i = m+1 # line_character_index
index = m+1 # total_list_index
while index < len(text_list):
while text_list[l * m + i] != ' ':
i -= 1
pass
text_list[l * m + i] = '\n'
l += 1
i = m+1
index += m+1
pass
text_str = ''.join(text_list)
print(text_str)
I guess we'll take this from the top.
text_str = file.read().replace('\n', '')
Here's one assumption about the input data I don't know if it's true. You're replacing all the newline characters with nothing; if there weren't spaces next to them, this means the code below will never break the lines in the same places.
text_list = list(text_str) # convert string to list
This splits the input file into single character strings. I guess you might have done so to make it mutable, such that you can replace individual characters, but it's a very expensive operation and loses all the features of a string. Python is a high level language that would allow you to split into e.g. words instead.
index = m+1 # total_list_index
while index < len(text_list):
#...
index += m+1
Let's consider what this means. We're not entering into the loop if index exceeds the text_list length. But index is advancing in steps of m+1. So we're splitting math.floor(len(text)/(max_line_length+1)) times. Unless every line is exactly max_line_length characters, not counting its space we replace with a newline, that's too few times. Too few times means too long lines, at least at the end.
l = 0; # line_number
i = m+1 # line_character_index
#loop:
while text_list[l * m + i] != ' ':
i -= 1
text_list[l * m + i] = '\n'
l += 1
i = m+1
This is making things difficult with index math. Quite clearly the one index we ever use is l * m + i. This moves in a quite odd way; it searches backwards for a space, then leaps forward as l increments and i resets. Whatever position it had reversed to is lost as all the leaps are in steps of m.
Let's apply m=5 to the string "Fee fie faw fum who did you see now". For the first iteration, 0 * 5 + 5+1 hits the second word, and i seeks back to the first space. The first line then is "Fee", as expected. The second search starts at 1*5 + 5+1, which is a space, and the second line becomes "fie faw", which already exceeds our limit of 5! The reason is that l * m isn't the beginning of the line; it's actually in the middle of "fie", a discrepancy which can only grow as you continue through the file. It grows whenever you split off a line that is shorter than m.
The solution involves remembering where you did your split. That could be as simple as replacing l * m with index, and updating it by index += i instead of m+1.
Another odd effect happens if you ever encounter a word that exceeds the maximum line length. Beyond meaning a line is longer than the limit, i will still search backwards until it finds a space; that space could then be in an earlier line altogether, producing extra short lines as well as too long ones. That's a result of handling the entire text as one array and not limiting which section we're looking at.
Personally I'd much rather use Python's built in methods, such as str.rindex, which can find a particular character in a given region within a string:
s = "Fee fie faw fum who did you see now"
maxlen = 5
start = 8
end = s.rindex(' ', start, start+maxlen)
print(s[start:end])
start = end + 1
We also, as PaulMcG pointed out, can go full "batteries included" and use the standard library textwrap module for the entire task.
Python: 2.7.9
I erased all of my code because I'm going nuts.
Here's the gist (its for Rosalind challenge thingy):
I want to take a file that looks like this (no quotes on carets)
">"Rosalind_0304
actgatcgtcgctgtactcg
actcgactacgtagctacgtacgctgcatagt
">"Rosalind_2480
gctatcggtactgcgctgctacgtg
ccccccgaagaatagatag
">"Rosalind_2452
cgtacgatctagc
aaattcgcctcgaactcg
etc...
What I can't figure out how to do is basically everything at this point, my mind is so muddled. I'll just show kind of what I was doing, but failing to do.
1st. I want to search the file for '>'
Then assign the rest of that line into the dictionary as a key.
read the next lines up until the next '>' and do some calculations and return
findings into the value for that key.
go through the file and do it for every string.
then compare all values and return the key of whichever one is highest.
Can anyone help?
It might help if I just take a break. I've been coding all day and i think I smell colors.
def func(dna_str):
bla
return gcp #gc count percentage returned to the value in dict
With my_function somewhere that returns that percentage value:
with open('rosalind.txt', 'r') as ros:
rosa = {line[1:].split(' ')[0]:my_function(line.split(' ')[1].strip()) for line in ros if line.strip()}
top_key = max(rosa, key=rosa.get)
print(top_key, rosa.get(top_key))
For each line in the file, that will first check if there's anything left of the line after stripping trailing whitespace, then discard the blank lines. Next, it adds each non-blank line as an entry to a dictionary, with the key being everything to the left of the space except for the unneeded >, and the value being the result of sending everything to the right of the space to your function.
Then it saves the key corresponding to the highest value, then prints that key along with its corresponding value. You're left with a dictionary rosa that you can process however you like.
Complete code of the module:
def my_function(dna):
return 100 * len(dna.replace('A','').replace('T',''))/len(dna)
with open('rosalind.txt', 'r') as ros:
with open('rosalind_clean.txt', 'w') as output:
for line in ros:
if line.startswith('>'):
output.write('\n'+line.strip())
elif line.strip():
output.write(line.strip())
with open('rosalind_clean.txt', 'r') as ros:
rosa = {line[1:].split(' ')[0]:my_function(line.split(' ')[1].strip()) for line in ros if line.strip()}
top_key = max(rosa, key=rosa.get)
print(top_key, rosa.get(top_key))
Complete content of rosalind.txt:
>Rosalind_6404 CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCG
TTTCTCTGAGGCTTCCGGCCTTCCCTCCCACTAATAATTCTGAGG
>Rosalind_5959 CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCA
GGCGCTCCGCCGAAGGTCTATATCCA
TTTGTCAGCAGACACGC
>Rosalind_0808 CCACCCTCGTGGT
ATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGACTGGGAACCTGCGGGCAGTAGGTGGAAT
Result when running the module:
Rosalind_0808 60.91954022988506
This should properly handle an input file that doesn't necessarily have one entry per line.
See SO's formatting guide to learn how to make inline or block code tags to get past things like ">". If you want it to appear as regular text rather than code, escape the > with a backslash:
Type:
\>Rosalind
Result:
>Rosalind
I think I got that part down now. Thanks so much. BUUUUT. Its throwing an error about it.
rosa = {line[1:].split(' ')[0]:calc(line.split(' ')[1].strip()) for line in ros if line.strip()}
IndexError: list index out of range
this is my func btw.
def calc(dna_str):
for x in dna_str:
if x == 'G':
gc += 1
divc += 1
elif x == 'C':
gc += 1
divc += 1
else:
divc += 1
gcp = float(gc/divc)
return gcp
Exact test file. no blank lines before or after.
>Rosalind_6404
CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC
TCCCACTAATAATTCTGAGG
>Rosalind_5959
CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT
ATATCCATTTGTCAGCAGACACGC
>Rosalind_0808
CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC
TGGGAACCTGCGGGCAGTAGGTGGAAT
I have recently been learning some Python and how to apply it to my work. I have written a couple of scripts successfully, but I am having an issue I just cannot figure out.
I am opening a file with ~4000 lines, two tab separated columns per line. When reading the input file, I get an index error saying that the list index is out of range. However, while I get the error every time, it doesn't happen on the same line every time (as in, it will throw the error on different lines everytime!). So, for some reason, it works generally but then (seemingly) randomly fails.
As I literally only started learning Python last week, I am stumped. I have looked around for the same problem, but not found anything similar. Furthermore I don't know if this is a problem that is language specific or IPython specific. Any help would be greatly appreciated!
input = open("count.txt", "r")
changelist = []
listtosort = []
second = str()
output = open("output.txt", "w")
for each in input:
splits = each.split("\t")
changelist = list(splits[0])
second = int(splits[1])
print second
if changelist[7] == ";":
changelist.insert(6, "000")
va = "".join(changelist)
var = va + ("\t") + str(second)
listtosort.append(var)
output.write(var)
elif changelist[8] == ";":
changelist.insert(6, "00")
va = "".join(changelist)
var = va + ("\t") + str(second)
listtosort.append(var)
output.write(var)
elif changelist[9] == ";":
changelist.insert(6, "0")
va = "".join(changelist)
var = va + ("\t") + str(second)
listtosort.append(var)
output.write(var)
else:
#output.write(str("".join(changelist)))
va = "".join(changelist)
var = va + ("\t") + str(second)
listtosort.append(var)
output.write(var)
output.close()
The error
---------------------------------------------------------------------------
IndexError Traceback (most recent call last)
/home/a/Desktop/sharedfolder/ipytest/individ.ins.count.test/<ipython-input-87-32f9b0a1951b> in <module>()
57 splits = each.split("\t")
58 changelist = list(splits[0])
---> 59 second = int(splits[1])
60
61 print second
IndexError: list index out of range
Input:
ID=cds0;Name=NP_414542.1;Parent=gene0;Dbxref=ASAP:ABE-0000006,UniProtKB%2FSwiss-Prot:P0AD86,Genbank:NP_414542.1,EcoGene:EG11277,GeneID:944742;gbkey=CDS;product=thr 12
ID=cds1000;Name=NP_415538.1;Parent=gene1035;Dbxref=ASAP:ABE-0003451,UniProtKB%2FSwiss-Prot:P31545,Genbank:NP_415538.1,EcoGene:EG11735,GeneID:946500;gbkey=CDS;product=deferrrochelatase%2C 50
ID=cds1001;Name=NP_415539.1;Parent=gene1036;Note=PhoB-dependent%2C 36
Desired output:
ID=cds0000;Name=NP_414542.1;Parent=gene0;Dbxref=ASAP:ABE-0000006,UniProtKB%2FSwiss-Prot:P0AD86,Genbank:NP_414542.1,EcoGene:EG11277,GeneID:944742;gbkey=CDS;product=thr 12
ID=cds1000;Name=NP_415538.1;Parent=gene1035;Dbxref=ASAP:ABE-0003451,UniProtKB%2FSwiss-Prot:P31545,Genbank:NP_415538.1,EcoGene:EG11735,GeneID:946500;gbkey=CDS;product=deferrrochelatase%2C 50
ID=cds1001;Name=NP_415539.1;Parent=gene1036;Note=PhoB-dependent%2C 36
The reason you're getting the IndexError is that your input-file is apparently not entirely tab delimited. That's why there is nothing at splits[1] when you attempt to access it.
Your code could use some refactoring. First of all you're repeating yourself with the if-checks, it's unnecessary. This just pads the cds0 to 7 characters which is probably not what you want. I threw the following together to demonstrate how you could refactor your code to be a little more pythonic and dry. I can't guarantee it'll work with your dataset, but I'm hoping it might help you understand how to do things differently.
to_sort = []
# We can open two files using the with statement. This will also handle
# closing the files for us, when we exit the block.
with open("count.txt", "r") as inp, open("output.txt", "w") as out:
for each in inp:
# Split at ';'... So you won't have to worry about whether or not
# the file is tab delimited
changed = each.split(";")
# Get the value you want. This is called unpacking.
# The value before '=' will always be 'ID', so we don't really care about it.
# _ is generally used as a variable name when the value is discarded.
_, value = changed[0].split("=")
# 0-pad the desired value to 7 characters. Python string formatting
# makes this very easy. This will replace the current value in the list.
changed[0] = "ID={:0<7}".format(value)
# Join the changed-list with the original separator and
# and append it to the sort list.
to_sort.append(";".join(changed))
# Write the results to the file all at once. Your test data already
# provided the newlines, you can just write it out as it is.
output.writelines(to_sort)
# Do what else you need to do. Maybe to_list.sort()?
You'll notice that this code is reduces your code down to 8 lines but achieves the exact same thing, does not repeat itself and is pretty easy to understand.
Please read the PEP8, the Zen of python, and go through the official tutorial.
This happens when there is a line in count.txt which doesn't contain the tab character. So when you split by tab character there will not be any splits[1]. Hence the error "Index out of range".
To know which line is causing the error, just add a print(each) after splits in line 57. The line printed before the error message is your culprit. If your input file keeps changing, then you will get different locations. Change your script to handle such malformed lines.