We Keep Coding

Is there a regrex script that can be used to extract texts by defining a start and an end in a text file [duplicate]

Let's say I have a string 'gfgfdAAA1234ZZZuijjk' and I want to extract just the '1234' part.
I only know what will be the few characters directly before AAA, and after ZZZ the part I am interested in 1234.
With sed it is possible to do something like this with a string:
echo "$STRING" | sed -e "s|.*AAA\(.*\)ZZZ.*|\1|"
And this will give me 1234 as a result.
How to do the same thing in Python?

Using regular expressions - documentation for further reference
import re
text = 'gfgfdAAA1234ZZZuijjk'
m = re.search('AAA(.+?)ZZZ', text)
if m:
found = m.group(1)
# found: 1234
or:
import re
text = 'gfgfdAAA1234ZZZuijjk'
try:
found = re.search('AAA(.+?)ZZZ', text).group(1)
except AttributeError:
# AAA, ZZZ not found in the original string
found = '' # apply your error handling
# found: 1234

>>> s = 'gfgfdAAA1234ZZZuijjk'
>>> start = s.find('AAA') + 3
>>> end = s.find('ZZZ', start)
>>> s[start:end]
'1234'
Then you can use regexps with the re module as well, if you want, but that's not necessary in your case.

regular expression
import re
re.search(r"(?<=AAA).*?(?=ZZZ)", your_text).group(0)
The above as-is will fail with an AttributeError if there are no "AAA" and "ZZZ" in your_text
string methods
your_text.partition("AAA")[2].partition("ZZZ")[0]
The above will return an empty string if either "AAA" or "ZZZ" don't exist in your_text.
PS Python Challenge?

Surprised that nobody has mentioned this which is my quick version for one-off scripts:
>>> x = 'gfgfdAAA1234ZZZuijjk'
>>> x.split('AAA')[1].split('ZZZ')[0]
'1234'

you can do using just one line of code
>>> import re
>>> re.findall(r'\d{1,5}','gfgfdAAA1234ZZZuijjk')
>>> ['1234']
result will receive list...

import re
print re.search('AAA(.*?)ZZZ', 'gfgfdAAA1234ZZZuijjk').group(1)

You can use re module for that:
>>> import re
>>> re.compile(".*AAA(.*)ZZZ.*").match("gfgfdAAA1234ZZZuijjk").groups()
('1234,)

In python, extracting substring form string can be done using findall method in regular expression (re) module.
>>> import re
>>> s = 'gfgfdAAA1234ZZZuijjk'
>>> ss = re.findall('AAA(.+)ZZZ', s)
>>> print ss
['1234']

text = 'I want to find a string between two substrings'
left = 'find a '
right = 'between two'
print(text[text.index(left)+len(left):text.index(right)])
Gives
string

>>> s = '/tmp/10508.constantstring'
>>> s.split('/tmp/')[1].split('constantstring')[0].strip('.')

With sed it is possible to do something like this with a string:
echo "$STRING" | sed -e "s|.*AAA\(.*\)ZZZ.*|\1|"
And this will give me 1234 as a result.
You could do the same with re.sub function using the same regex.
>>> re.sub(r'.*AAA(.*)ZZZ.*', r'\1', 'gfgfdAAA1234ZZZuijjk')
'1234'
In basic sed, capturing group are represented by \(..\), but in python it was represented by (..).

You can find first substring with this function in your code (by character index). Also, you can find what is after a substring.
def FindSubString(strText, strSubString, Offset=None):
try:
Start = strText.find(strSubString)
if Start == -1:
return -1 # Not Found
else:
if Offset == None:
Result = strText[Start+len(strSubString):]
elif Offset == 0:
return Start
else:
AfterSubString = Start+len(strSubString)
Result = strText[AfterSubString:AfterSubString + int(Offset)]
return Result
except:
return -1
# Example:
Text = "Thanks for contributing an answer to Stack Overflow!"
subText = "to"
print("Start of first substring in a text:")
start = FindSubString(Text, subText, 0)
print(start); print("")
print("Exact substring in a text:")
print(Text[start:start+len(subText)]); print("")
print("What is after substring \"%s\"?" %(subText))
print(FindSubString(Text, subText))
# Your answer:
Text = "gfgfdAAA1234ZZZuijjk"
subText1 = "AAA"
subText2 = "ZZZ"
AfterText1 = FindSubString(Text, subText1, 0) + len(subText1)
BeforText2 = FindSubString(Text, subText2, 0)
print("\nYour answer:\n%s" %(Text[AfterText1:BeforText2]))

Using PyParsing
import pyparsing as pp
word = pp.Word(pp.alphanums)
s = 'gfgfdAAA1234ZZZuijjk'
rule = pp.nestedExpr('AAA', 'ZZZ')
for match in rule.searchString(s):
print(match)
which yields:
[['1234']]

One liner with Python 3.8 if text is guaranteed to contain the substring:
text[text.find(start:='AAA')+len(start):text.find('ZZZ')]

Just in case somebody will have to do the same thing that I did. I had to extract everything inside parenthesis in a line. For example, if I have a line like 'US president (Barack Obama) met with ...' and I want to get only 'Barack Obama' this is solution:
regex = '.*\((.*?)\).*'
matches = re.search(regex, line)
line = matches.group(1) + '\n'
I.e. you need to block parenthesis with slash \ sign. Though it is a problem about more regular expressions that Python.
Also, in some cases you may see 'r' symbols before regex definition. If there is no r prefix, you need to use escape characters like in C. Here is more discussion on that.

also, you can find all combinations in the bellow function
s = 'Part 1. Part 2. Part 3 then more text'
def find_all_places(text,word):
word_places = []
i=0
while True:
word_place = text.find(word,i)
i+=len(word)+word_place
if i>=len(text):
break
if word_place<0:
break
word_places.append(word_place)
return word_places
def find_all_combination(text,start,end):
start_places = find_all_places(text,start)
end_places = find_all_places(text,end)
combination_list = []
for start_place in start_places:
for end_place in end_places:
print(start_place)
print(end_place)
if start_place>=end_place:
continue
combination_list.append(text[start_place:end_place])
return combination_list
find_all_combination(s,"Part","Part")
result:
['Part 1. ', 'Part 1. Part 2. ', 'Part 2. ']

In case you want to look for multiple occurences.
content ="Prefix_helloworld_Suffix_stuff_Prefix_42_Suffix_andsoon"
strings = []
for c in content.split('Prefix_'):
spos = c.find('_Suffix')
if spos!=-1:
strings.append( c[:spos])
print( strings )
Or more quickly :
strings = [ c[:c.find('_Suffix')] for c in content.split('Prefix_') if c.find('_Suffix')!=-1 ]

Here's a solution without regex that also accounts for scenarios where the first substring contains the second substring. This function will only find a substring if the second marker is after the first marker.
def find_substring(string, start, end):
len_until_end_of_first_match = string.find(start) + len(start)
after_start = string[len_until_end_of_first_match:]
return string[string.find(start) + len(start):len_until_end_of_first_match + after_start.find(end)]

Another way of doing it is using lists (supposing the substring you are looking for is made of numbers, only) :
string = 'gfgfdAAA1234ZZZuijjk'
numbersList = ['0', '1', '2', '3', '4', '5', '6', '7', '8', '9']
output = []
for char in string:
if char in numbersList: output.append(char)
print(f"output: {''.join(output)}")
### output: 1234

Typescript. Gets string in between two other strings.
Searches shortest string between prefixes and postfixes
prefixes - string / array of strings / null (means search from the start).
postfixes - string / array of strings / null (means search until the end).
public getStringInBetween(str: string, prefixes: string | string[] | null,
postfixes: string | string[] | null): string {
if (typeof prefixes === 'string') {
prefixes = [prefixes];
}
if (typeof postfixes === 'string') {
postfixes = [postfixes];
}
if (!str || str.length < 1) {
throw new Error(str + ' should contain ' + prefixes);
}
let start = prefixes === null ? { pos: 0, sub: '' } : this.indexOf(str, prefixes);
const end = postfixes === null ? { pos: str.length, sub: '' } : this.indexOf(str, postfixes, start.pos + start.sub.length);
let value = str.substring(start.pos + start.sub.length, end.pos);
if (!value || value.length < 1) {
throw new Error(str + ' should contain string in between ' + prefixes + ' and ' + postfixes);
}
while (true) {
try {
start = this.indexOf(value, prefixes);
} catch (e) {
break;
}
value = value.substring(start.pos + start.sub.length);
if (!value || value.length < 1) {
throw new Error(str + ' should contain string in between ' + prefixes + ' and ' + postfixes);
}
}
return value;
}

a simple approach could be the following:
string_to_search_in = 'could be anything'
start = string_to_search_in.find(str("sub string u want to identify"))
length = len("sub string u want to identify")
First_part_removed = string_to_search_in[start:]
end_coord = length
Extracted_substring=First_part_removed[:end_coord]

One liners that return other string if there was no match.
Edit: improved version uses next function, replace "not-found" with something else if needed:
import re
res = next( (m.group(1) for m in [re.search("AAA(.*?)ZZZ", "gfgfdAAA1234ZZZuijjk" ),] if m), "not-found" )
My other method to do this, less optimal, uses regex 2nd time, still didn't found a shorter way:
import re
res = ( ( re.search("AAA(.*?)ZZZ", "gfgfdAAA1234ZZZuijjk") or re.search("()","") ).group(1) )

find substring between "a" and "(" + 2 unknown characters +")"

I have some strings which are built this way:
string = "blabla y the_blabla_I_want (two_digits_number) blabla"
I would like to get the_blabla_I_want.
I know the re.search can help but my problem is about how to represent (two_digits_number).

To represent (two_digits_number), you may use "\([0-9]{2}\)".
Here is a regex tutorial in python.
To get the_blabla_I_want, you may try the following code:
import re
x = re.search("y (.*) \([0-9]{2}\)", str)
x[1]
Depends on how you define the two digits number, yo may want to change "\([0-9]{2}" to "\([1-9][0-9])" to avoid numbers have leading zero

string = "blabla y the_blabla_I_want (99) blabla"
if string.count("(") == 1 and string.count(")") == 1:
start_idx = string.find("(")
end_idx = string.find(")")
two_digits_number = string[start_idx+1:end_idx]
print(two_digits_number) # output: 99
two_digits_number = string[start_idx:end_idx+1]
print(two_digits_number) # output: (99)

Add ": " for every nth character in a list

Say i have this:
x = ["hello-543hello-454hello-765", "hello-745hello-635hello-321"]
how can i get the output to:
["hello-543: hello-454: hello-765", "hello-745: hello-635: hello-321"]

You can split each string based on substring length with a list comprehension using range where the step value is the number of characters each substring should contain. Then use join to convert each list back to a string with the desired separator characters.
x = ["hello-543hello-454hello-765", "hello-745hello-635hello-321"]
n = 9
result = [': '.join([s[i:i+n] for i in range(0, len(s), n)]) for s in x]
print(result)
# ['hello-543: hello-454: hello-765', 'hello-745: hello-635: hello-321']
Or with textwrap.wrap:
from textwrap import wrap
x = ["hello-543hello-454hello-765", "hello-745hello-635hello-321"]
n = 9
result = [': '.join(wrap(s, n)) for s in x]
print(result)
# ['hello-543: hello-454: hello-765', 'hello-745: hello-635: hello-321']

If you are sure every str length is multiply of your n, I would use re.findall for that task.
import re
txt1 = "hello-543hello-454hello-765"
txt2 = "hello-745hello-635hello-321"
out1 = ": ".join(re.findall(r'.{9}',txt1))
out2 = ": ".join(re.findall(r'.{9}',txt2))
print(out1) #hello-543: hello-454: hello-765
print(out2) #hello-745: hello-635: hello-321
.{9} in re.findall mean 9 of any characters excluding newline (\n), so this code would work properly as long as your strs do not contain \n. If this does not hold true you need to add re.DOTALL as third argument of re.findall

Replacing a certain number of characters only

I was wondering if anyone could help provide some insight on the following problem that I am currently struggling with.
Let's assume that you have a file that contains the following characters:
|**********|
You have another file that contains a pattern, such as:
-
/-\
/---\
/-----\
/-------\
How would you go about replacing the characters in the pattern with the characters from the first file BUT at the same time - you can only print the specific number of *'s that are in the first file.
Once you have printed say the 10 stars, in total, you have to STOP printing.
So it would be something like:
*
***
*****
*
Any hints or tips or help would be greatly appreciated.
I have been using .replace() to replace all of the characters in the pattern with the '*' but I am unable to print the specific amount only.
for ch in ['-', '/', '\\']:
if ch in form:
form = form.replace(ch, '*')

Here's my aestric file(aestricks.txt), which contains:
************
And pattern file (pattern.txt), which contains:
-
/-\
/---\
/-----\
/-------\
And here's the code. I know it can be optimized a little more, but I am posting the basic one:
file1 = open("aestricks.txt","r")
file1 = file1.read()
t_c = len(file1)
form = open("pattern.txt","r")
form = form.read()
form1 = form
count = 0
for ch in form1:
if ch in ['-','/', '\\']:
form = form.replace(ch, '*', 1)
count += 1
if count == t_c:
break
for ch in form1:
if ch in ['-','/', '\\']:
form = form.replace(ch, '')
print(form)
OUTPUT:
*
***
*****
***

You can use regular expressions and sub() function from re module.
sub() takes an optional count argument that indicates the maximal number of pattern occurrences to be replaced.
import re
with open('asterisks.txt') as asterisks_file, open('ascii_art.txt') as ascii_art_file:
pattern = re.compile(r'[' # match one from within square brackets:
r'\\' # either backslash
r'/' # or slash
r'-' # or hyphen
r']')
# let n be the number of asterisks from the first file
n = asterisks_file.read().count('*')
# replace first n matches of our pattern (one of /\- characters)
replaced_b = pattern.sub('*', ascii_art_file.read(), n)
# replace rest of the /\- characters with spaces (based on your example)
result = pattern.sub(' ', replaced_b)
print(result)
OUTPUT:
*
***
*****
*

Instead of replacing every character at once you can replace items one at a time and use some count on number of replacements.
But str object doesn't support item assignment at specific index, so you have to convert the str object into list first. Then do your operations and convert back to str again.
you can write something like this.
characters = ['-', '/', '\\']
count = 0
a = list(form) # convert your string to list
for i in range(len(a)):
if a[i] in characters and count < 10: # iterate through each character
a[i] = '*' # replace with '*'
count += 1 # increment count
result = "".join(a) # convert list back into str
print(result)

import re
file1 = open("file1.txt", "r")
s=file1.read()
starcount=s.count('*')
file2 = open("file2.txt", "r")
line = re.sub(r'[-|\\|/]', r'*', file2.read(), starcount)
line = re.sub(r'[-|\\|/]', r'', line)
print(line)
Syntax of sub
>>> import re
>>> help(re.sub)
Help on function sub in module re:
sub(pattern, repl, string, count=0, flags=0)
Return the string obtained by replacing the leftmost
non-overlapping occurrences of the pattern in string by the
replacement repl. repl can be either a string or a callable;
if a string, backslash escapes in it are processed. If it is
a callable, it's passed the match object and must return
a replacement string to be used.
Output
*
***
*****
*
Demo
https://repl.it/repls/ObeseNoteworthyDevelopment

You just need to keep track of the number of * in the input line and then continue to replace the dashes until the counter runs out. Once the counter runs out then replace the remaining dashes with empty strings.
def replace(p, s):
counter = len(s) - 2
chars = ['\\', '/', '-']
i = 0
for c in p:
if c in chars:
p = p.replace(c, '*', 1)
i += 1
if i == counter:
break
p = p.replace('\\', '')
p = p.replace('/', '')
p = p.replace('-', '')
return p
if __name__ == '__main__':
stars = '|**********|'
pyramid = r'''
-
/-\
/---\
/-----\
/-------\ '''
print(pyramid)
print(replace(pyramid, stars))
OUTPUT
*
***
*****
*

import re
inp = open('stars.txt', 'r').read()
count = len(inp.strip('|')) #stripping off the extra characters from either end
pattern = open('pattern.txt', 'r').read() # read the entire pattern
out = re.sub(r'-|/|\\', r'*', pattern, count=count) # for any of the characters in '-' or '|' or '\', replace them with a '*' only **count** number of times.
out = re.sub(r'-|/|\\', r'', out) # to remove the left out characters
print (out)
Added one more re.sub line to remove the left out characters if any.

Cut string within a specific pattern in python

I have string of some length consisting of only 4 characters which are 'A,T,G and C'. I have pattern 'GAATTC' present multiple times in the given string. I have to cut the string at intervals where this pattern is..
For example for a string, 'ATCGAATTCATA', I should get output of
string one - ATCGA
string two - ATTCATA
I am newbie in using Python but I have come up with the following (incomplete) code:
seq = seq.upper()
str1 = "GAATTC"
seqlen = len(seq)
seq = list(seq)
for i in range(0,seqlen-1):
site = seq.find(str1)
print(site[0:(i+2)])
Any help would be really appreciated.

First lets develop your idea of using find, so you can figure out your mistakes.
seq = 'ATCGAATTCATAATCGAATTCATAATCGAATTCATA'
seq = seq.upper()
pattern = "GAATTC"
split_at = 2
seqlen = len(seq)
i = 0
while i < seqlen:
site = seq.find(pattern, i)
if site != -1:
print(seq[i: site + split_at])
i = site + split_at
else:
print seq[i:]
break
Yet python string sports a powerful replace method that directly replaces fragments of string. The below snippet uses the replace method to insert separators when needed:
seq = 'ATCGAATTCATAATCGAATTCATAATCGAATTCATA'
seq = seq.upper()
pattern = "GA","ATTC"
pattern1 = ''.join(pattern) # 'GAATTC'
pattern2 = ' '.join(pattern) # 'GA ATTC'
splited_seq = seq.replace(pattern1, pattern2) # 'ATCGA ATTCATAATCGA ATTCATAATCGA ATTCATA'
print (splited_seq.split())
I believe it is more intuitive and should be faster then RE (which might have lower performance, depending on library and usage)

Here is a simple solution :
seq = 'ATCGAATTCATA'
seq_split = seq.upper().split('GAATTC')
result = [
(seq_split[i] + 'GA') if i % 2 == 0 else ('ATTC' + seq_split[i])
for i in range(len(seq_split)) if len(seq_split[i]) > 0
]
Result :
print(result)
['ATCGA', 'ATTCATA']

BioPython has a restriction enzyme package to do exactly what you're asking.
from Bio.Restriction import *
from Bio.Alphabet.IUPAC import IUPACAmbiguousDNA
print(EcoRI.site) # You will see that this is the enzyme you listed above
test = 'ATCGAATTCATA'.upper() # This is the sequence you want to search
my_seq = Seq(test, IUPACAmbiguousDNA()) # Create a biopython Seq object with our sequence
cut_sites = EcoRI.search(my_seq)
cut_sites contain a list of exactly where to cut the input sequence (such that GA is in the left sequence and ATTC is in the right sequence.
You can then split the sequence into contigs using:
cut_sites = [0] + cut_sites # We add a leading zero so this works for the first
# contig. This might not always be needed.
contigs = [test[i:j] for i,j in zip(cut_sites, cut_sites[1:]+[None])]
You can see this page for more details about BioPython.

My code is a bit sloppy, but you could try something like this when you want to iterate over multiple occurrences of the string
def split_strings(seq):
string1 = seq[:seq.find(str1) +2]
string2 = seq[seq.find(str1) +2:]
return string1, string2
test = 'ATCGAATTCATA'.upper()
str1 = 'GAATTC'
seq = test
while str1 in seq:
string1, seq = split_strings(seq)
print string1
print seq

Here's a solution using the regular expression module:
import re
seq = 'ATCGAATTCATA'
restriction_site = re.compile('GAATTC')
subseq_start = 0
for match in restriction_site.finditer(seq):
print seq[subseq_start:match.start()+2]
subseq_start = match.start()+2
print seq[subseq_start:]
Output:
ATCGA
ATTCATA