Uploading file using Python Selenium System via system window - python

I am taking a trial website case to learn to upload files using Python Selenium where the upload window is not a part of the HTML. The upload window is a system level update. This is already solved using JAVA (stackoverflow link(s) below). If this is not possible via Python then I intent to shift to JAVA for this task.
BUT,
Dear all my fellow Python lovers, why shouldn't it be possible using Python webdriver-Selenium. Hence this quest.
Solved in JAVA for URL: http://www.zamzar.com/
Solution (& JAVA code) in stackoverflow: How to handle windows file upload using Selenium WebDriver?
This is my Python code that should be self explanatory, inclusive of chrome webdriver download links.
Task (uploading file) I am trying in brief:
Website: https://www.wordtopdf.com/
Note_1: I don't need this tool for any work as there are far better packages to do this word to pdf conversion. Instead, this is just for learning & polishing Python Selenium code/application.
Note_2: You will have to painstakingly enter 2 paths into my code below after downloading and unzipping the chrome driver (link below in comments). The 2 paths are: [a] Path of a(/any) word file & [b] path of the unzipped chrome driver.
My Code:
from selenium import webdriver
UNZIPPED_DRIVER_PATH = 'C:/Users/....' # You need to specify this on your computer
driver = webdriver.Chrome(executable_path = UNZIPPED_DRIVER_PATH)
# Driver download links below (check which version of chrome you are using if you don't know it beforehand):
# Chrome Driver 74 Download: https://chromedriver.storage.googleapis.com/index.html?path=74.0.3729.6/
# Chrome Driver 73 Download: https://chromedriver.storage.googleapis.com/index.html?path=73.0.3683.68/
New_Trial_URL = 'https://www.wordtopdf.com/'
driver.get(New_Trial_URL)
time.sleep(np.random.uniform(4.5, 5.5, size = 1)) # Time to load the page in peace
Find_upload = driver.find_element_by_xpath('//*[#id="file-uploader"]')
WORD_FILE_PATH = 'C:/Users/..../some_word_file.docx' # You need to specify this on your computer
Find_upload.send_keys(WORD_FILE_PATH) # Not working, no action happens here
Based on something very similar in JAVA (How to handle windows file upload using Selenium WebDriver?), this should work like a charm. But Voila... total failure and thus chance to learn something new.
I have also tried:
Click_Alert = Find_upload.click()
Click_Alert(driver).send_keys(WORD_FILE_PATH)
Did not work. 'Alert' should be inbuilt function as per these 2 links (https://seleniumhq.github.io/selenium/docs/api/py/webdriver/selenium.webdriver.common.alert.html & Selenium-Python: interact with system modal dialogs).
But the 'Alert' function in the above link doesn't seem to exist in my Python setup even after executing
from selenium import webdriver
#All the readers, hope this doesn't take much of your time and we all get to learn something out of this.
Cheers

You get ('//*[#id="file-uploader"]') which is <a> tag
but there is hidden <input type="file"> (behind <a>) which you have to use
import selenium.webdriver
your_file = "/home/you/file.doc"
your_email = "you#example.com"
url = 'https://www.wordtopdf.com/'
driver = selenium.webdriver.Firefox()
driver.get(url)
file_input = driver.find_element_by_xpath('//input[#type="file"]')
file_input.send_keys(your_file)
email_input = driver.find_element_by_xpath('//input[#name="email"]')
email_input.send_keys(your_email)
driver.find_element_by_id('convert_now').click()
Tested with Firefox 66 / Linux Mint 19.1 / Python 3.7 / Selenium 3.141.0
EDIT: The same method for uploading on zamzar.com
Situation which I saw first time (so it took me longer time to create solution): it has <input type="file"> hidden under button but it doesn't use it to upload file. It create dynamically second <input type="file"> which uses to upload file (or maybe even many files - I didn't test it).
import selenium.webdriver
from selenium.webdriver.support.ui import Select
import time
your_file = "/home/furas/Obrazy/37884728_1975437959135477_1313839270464585728_n.jpg"
#your_file = "/home/you/file.jpg"
output_format = 'png'
url = 'https://www.zamzar.com/'
driver = selenium.webdriver.Firefox()
driver.get(url)
#--- file ---
# it has to wait because paga has to create second `input[#type="file"]`
file_input = driver.find_elements_by_xpath('//input[#type="file"]')
while len(file_input) < 2:
print('len(file_input):', len(file_input))
time.sleep(0.5)
file_input = driver.find_elements_by_xpath('//input[#type="file"]')
file_input[1].send_keys(your_file)
#--- format ---
select_input = driver.find_element_by_id('convert-format')
select = Select(select_input)
select.select_by_visible_text(output_format)
#--- convert ---
driver.find_element_by_id('convert-button').click()
#--- download ---
time.sleep(5)
driver.find_elements_by_xpath('//td[#class="status last"]/a')[0].click()

Related

Automatically upload images on vinted

I've been stuck on a task for a few days. I can't load images automatically on the vinted image browser. I tried running the following code:
from os import listdir
from os.path import isfile, join
from time import sleep
from pyautogui import press, write
from selenium.webdriver import Chrome
from selenium.webdriver.chrome.options import Options
from selenium.webdriver.chrome.service import Service
from selenium.webdriver.common.by import By
from webdriver_manager.chrome import ChromeDriverManager
def get_images(directory_path) -> str:
images: str = ""
f: str
image_name: str
for filename in listdir(directory_path):
f = join(directory_path, filename)
if isfile(f):
image_name = f.replace(f"{directory_path}\\", "")
images += f'\"{image_name}\" '
return directory_path + "\\" + images
option: Options = Options()
option.add_experimental_option("debuggerAddress", "localhost:8989")
driver: Chrome = Chrome(service=Service(ChromeDriverManager().install()),
options=option)
mode: str = By.CSS_SELECTOR
driver.maximize_window()
driver.get("https://www.vinted.it/items/new")
# * images
sleep(1)
driver.find_element(mode, "#photos > div.Cell_cell__3V4ao.Cell_wide__1ukxw > div > div > div > div.media-select__input > div > button").click()
sleep(1)
directory_path: str = r"C:\Users\Memmo\Pictures\Camera Roll"
write(get_images(directory_path))
press('enter')
The problem is that the paths of the recovered images end up on the terminal where the script is run, while they should be set in the upload window. It almost seems that the focus is lost.
I could also set the html of the image on the upload section but it seems a more complicated, expensive and risky way than the one already undertaken.
If someone has already faced "more custom" image browsers compared to the classic ones, I would be curious to know how solved this problem. Thanks in advance.
To upload the file you need to use xpath as "//div[#id='photos']/input"
here is the full code
driver.find_element(By.XPATH, "//div[#id='photos']/input").send_keys("<your image file path>")
Here is the screenshot that shows its working for me
You cannot access the upload window opened by the browser since selenium does not have access outside of the browser page.
You can archive this by installing some other python package that will allow you to have access to the opened window (given you are starting the browser in local machine) or much simpler way would be to get the file input field (in most cases hidden) and assign the image path to it.
Here is a small example: (have not tried it in vinted, I don't have an account there and I'm too lazy to verify my phone number :))
# [...]
# get the file input field
# (on most pages css: input[type="file"] or xpath: //input[#type="file"]
# would be enough, but check if there are more than one file input fields
# in which case you'd have to use index like [0],[1],[n]
# logic on waiting element
# [...]
fileInput = driver.find_element(mode, 'input[type="file"]')
fileInput.send_keys(get_images(directory_path))
# and finally click on the form submit button.
# [...]
If loosing focus on a desktop window is causing problem, than it can be easily fixed as following:
Create a .VBS file with following code at some location:
Set oShell = CreateObject("Wscript.shell")
oShell.AppActivate("<Enter the Window Title Here>")
Before sending any keys simple invoke the .vbs file to set the focus
P.S.
This solution only works on windows
Partial Windows title also work
I was unable to login to the website but I was able to look for some libraries for getting info ("https://github.com/aime-risson/vinted-api-wrapper") and ("https://github.com/hipsuc/Vinted-API/blob/main/VintedApi.py")

Save complete web page (incl css, images) using python/selenium

I am using Python/Selenium to submit genetic sequences to an online database, and want to save the full page of results I get back. Below is the code that gets me to the results I want:
from selenium import webdriver
URL = 'https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastx&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome'
SEQUENCE = 'CCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACA' #'GAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGA'
CHROME_WEBDRIVER_LOCATION = '/home/max/Downloads/chromedriver' # update this for your machine
# open page with selenium
# (first need to download Chrome webdriver, or a firefox webdriver, etc)
driver = webdriver.Chrome(executable_path=CHROME_WEBDRIVER_LOCATION)
driver.get(URL)
time.sleep(5)
# enter sequence into the query field and hit 'blast' button to search
seq_query_field = driver.find_element_by_id("seq")
seq_query_field.send_keys(SEQUENCE)
blast_button = driver.find_element_by_id("b1")
blast_button.click()
time.sleep(60)
At that point I have a page that I can manually click "save as," and get a local file (with a corresponding folder of image/js assets) that lets me view the whole returned page locally (minus content which is generated dynamically from scrolling down the page, which is fine). I assumed there would be a simple way to mimic this 'save as' function in python/selenium but haven't found one. The code to save the page below just saves html, and does not leave me with a local file that looks like it does in the web browser, with images, etc.
content = driver.page_source
with open('webpage.html', 'w') as f:
f.write(content)
I've also found this question/answer on SO, but the accepted answer just brings up the 'save as' box, and does not provide a way to click it (as two commenters point out)
Is there a simple way to 'save [full page] as' using python? Ideally I'd prefer an answer using selenium since selenium makes the crawling part so straightforward, but I'm open to using another library if there's a better tool for this job. Or maybe I just need to specify all of the images/tables I want to download in code, and there is no shortcut to emulating the right-click 'save as' functionality?
UPDATE - Follow up question for James' answer
So I ran James' code to generate a page.html (and associated files) and compared it to the html file I got from manually clicking save-as. The page.html saved via James' script is great and has everything I need, but when opened in a browser it also shows a lot of extra formatting text that's hidden in the manually save'd page. See attached screenshot (manually saved page on the left, script-saved page with extra formatting text shown on right).
This is especially surprising to me because the raw html of the page saved by James' script seems to indicate those fields should still be hidden. See e.g. the html below, which appears the same in both files, but the text at issue only appears in the browser-rendered page on the one saved by James' script:
<p class="helpbox ui-ncbitoggler-slave ui-ncbitoggler" id="hlp1" aria-hidden="true">
These options control formatting of alignments in results pages. The
default is HTML, but other formats (including plain text) are available.
PSSM and PssmWithParameters are representations of Position Specific Scoring Matrices and are only available for PSI-BLAST.
The Advanced view option allows the database descriptions to be sorted by various indices in a table.
</p>
Any idea why this is happening?
As you noted, Selenium cannot interact with the browser's context menu to use Save as..., so instead to do so, you could use an external automation library like pyautogui.
pyautogui.hotkey('ctrl', 's')
time.sleep(1)
pyautogui.typewrite(SEQUENCE + '.html')
pyautogui.hotkey('enter')
This code opens the Save as... window through its keyboard shortcut CTRL+S and then saves the webpage and its assets into the default downloads location by pressing enter. This code also names the file as the sequence in order to give it a unique name, though you could change this for your use case. If needed, you could additionally change the download location through some extra work with the tab and arrow keys.
Tested on Ubuntu 18.10; depending on your OS you may need to modify the key combination sent.
Full code, in which I also added conditional waits to improve speed:
import time
from selenium import webdriver
from selenium.webdriver.common.by import By
from selenium.webdriver.support.expected_conditions import visibility_of_element_located
from selenium.webdriver.support.ui import WebDriverWait
import pyautogui
URL = 'https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastx&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome'
SEQUENCE = 'CCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACA' #'GAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGA'
# open page with selenium
# (first need to download Chrome webdriver, or a firefox webdriver, etc)
driver = webdriver.Chrome()
driver.get(URL)
# enter sequence into the query field and hit 'blast' button to search
seq_query_field = driver.find_element_by_id("seq")
seq_query_field.send_keys(SEQUENCE)
blast_button = driver.find_element_by_id("b1")
blast_button.click()
# wait until results are loaded
WebDriverWait(driver, 60).until(visibility_of_element_located((By.ID, 'grView')))
# open 'Save as...' to save html and assets
pyautogui.hotkey('ctrl', 's')
time.sleep(1)
pyautogui.typewrite(SEQUENCE + '.html')
pyautogui.hotkey('enter')
This is not a perfect solution, but it will get you most of what you need. You can replicate the behavior of "save as full web page (complete)" by parsing the html and downloading any loaded files (images, css, js, etc.) to their same relative path.
Most of the javascript won't work due to cross origin request blocking. But the content will look (mostly) the same.
This uses requests to save the loaded files, lxml to parse the html, and os for the path legwork.
from selenium import webdriver
import chromedriver_binary
from lxml import html
import requests
import os
driver = webdriver.Chrome()
URL = 'https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastx&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome'
SEQUENCE = 'CCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACA'
base = 'https://blast.ncbi.nlm.nih.gov/'
driver.get(URL)
seq_query_field = driver.find_element_by_id("seq")
seq_query_field.send_keys(SEQUENCE)
blast_button = driver.find_element_by_id("b1")
blast_button.click()
content = driver.page_source
# write the page content
os.mkdir('page')
with open('page/page.html', 'w') as fp:
fp.write(content)
# download the referenced files to the same path as in the html
sess = requests.Session()
sess.get(base) # sets cookies
# parse html
h = html.fromstring(content)
# get css/js files loaded in the head
for hr in h.xpath('head//#href'):
if not hr.startswith('http'):
local_path = 'page/' + hr
hr = base + hr
res = sess.get(hr)
if not os.path.exists(os.path.dirname(local_path)):
os.makedirs(os.path.dirname(local_path))
with open(local_path, 'wb') as fp:
fp.write(res.content)
# get image/js files from the body. skip anything loaded from outside sources
for src in h.xpath('//#src'):
if not src or src.startswith('http'):
continue
local_path = 'page/' + src
print(local_path)
src = base + src
res = sess.get(hr)
if not os.path.exists(os.path.dirname(local_path)):
os.makedirs(os.path.dirname(local_path))
with open(local_path, 'wb') as fp:
fp.write(res.content)
You should have a folder called page with a file called page.html in it with the content you are after.
Inspired by FThompson's answer above, I came up with the following tool that can download full/complete html for a given page url (see: https://github.com/markfront/SinglePageFullHtml)
UPDATE - follow up with Max's suggestion, below are steps to use the tool:
Clone the project, then run maven to build:
$> git clone https://github.com/markfront/SinglePageFullHtml.git
$> cd ~/git/SinglePageFullHtml
$> mvn clean compile package
Find the generated jar file in target folder: SinglePageFullHtml-1.0-SNAPSHOT-jar-with-dependencies.jar
Run the jar in command line like:
$> java -jar .target/SinglePageFullHtml-1.0-SNAPSHOT-jar-with-dependencies.jar <page_url>
The result file name will have a prefix "FP, followed by the hashcode of the page url, with file extension ".html". It will be found in either folder "/tmp" (which you can get by System.getProperty("java.io.tmp"). If not, try find it in your home dir or System.getProperty("user.home") in Java).
The result file will be a big fat self-contained html file that includes everything (css, javascript, images, etc.) referred to by the original html source.
I'll advise u to have a try on sikulix which is an image based automation tool for operate any widgets within PC OS, it supports python grammar and run with command line and maybe the simplest way to solve ur problem.
All u need to do is just give it a screenshot, call sikulix script in ur python automation script(with OS.system("xxxx") or subprocess...).

Python Selenium Converted to Powershell

Looking to write a script for work to go to one of our websites and auto populate a page for submission. I have created this below with python below but I would like to avoid downloading anything extra onto our servers (ie. Python). Wondering if there is a library in powershell like selenium for python. Is there a way to find the xpath or name of buttons in IE like you do in chrome?
Python script below:
import time
from selenium import webdriver
#Go to website Site
driver = webdriver.Chrome("C:/WebDrivers/chromedriver.exe") # Optional argument, if not specified will search path.
driver.get('yourwebsite');
time.sleep(2) # Let page load!
#Log In with Credentials
search_box = driver.find_element_by_name("txtUserName")
search_box.send_keys('YourUsername')#Your Username
search_box1 = driver.find_element_by_name("txtPassword")
search_box1.send_keys('YourPassword')#Your Password
submit_button = driver.find_element_by_name('btnLogin')
submit_button.click()
time.sleep(10) # Let page load!

Python - Selenium - Print Webpage

How do I print a webpage using selenium please.
import time
from selenium import webdriver
# Initialise the webdriver
chromeOps=webdriver.ChromeOptions()
chromeOps._binary_location = "C:\\Program Files\\Google\\Chrome\\Application\\chrome.exe"
chromeOps._arguments = ["--enable-internal-flash"]
browser = webdriver.Chrome("C:\\Program Files\\Google\\Chrome\\Application\\chromedriver.exe", port=4445, chrome_options=chromeOps)
time.sleep(3)
# Login to Webpage
browser.get('www.webpage.com')
Note: I am using the, at present, current version of Google Chrome: Version 32.0.1700.107 m
While it's not directly printing the webpage, it is easy to take a screenshot of the entire current page:
browser.save_screenshot("screenshot.png")
Then the image can be printed using any image printing library. I haven't personally used any such library so I can't necessarily vouch for it, but a quick search turned up win32print which looks promising.
The key "trick" is that we can execute JavaScript in the selenium browser window using the "execute_script" method of the selenium webdriver, and if you execute the JavaScript command "window.print();" it will activate the browsers print function.
Now, getting it to work elegantly requires setting a few preferences to print silently, remove print progress reporting, etc. Here is a small but functional example that loads up and prints whatever website you put in the last line (where 'http://www.cnn.com/' is now):
import time
from selenium import webdriver
import os
class printing_browser(object):
def __init__(self):
self.profile = webdriver.FirefoxProfile()
self.profile.set_preference("services.sync.prefs.sync.browser.download.manager.showWhenStarting", False)
self.profile.set_preference("pdfjs.disabled", True)
self.profile.set_preference("print.always_print_silent", True)
self.profile.set_preference("print.show_print_progress", False)
self.profile.set_preference("browser.download.show_plugins_in_list",False)
self.driver = webdriver.Firefox(self.profile)
time.sleep(5)
def get_page_and_print(self, page):
self.driver.get(page)
time.sleep(5)
self.driver.execute_script("window.print();")
if __name__ == "__main__":
browser_that_prints = printing_browser()
browser_that_prints.get_page_and_print('http://www.cnn.com/')
The key command you were probably missing was "self.driver.execute_script("window.print();")" but one needs some of that setup in init to make it run smooth so I thought I'd give a fuller example. I think the trick alone is in a comment above so some credit should go there too.

How can I download a file on a click event using selenium?

I am working on python and selenium. I want to download file from clicking event using selenium. I wrote following code.
from selenium import webdriver
from selenium.common.exceptions import NoSuchElementException
from selenium.webdriver.common.keys import Keys
browser = webdriver.Firefox()
browser.get("http://www.drugcite.com/?q=ACTIMMUNE")
browser.close()
I want to download both files from links with name "Export Data" from given url. How can I achieve it as it works with click event only?
Find the link using find_element(s)_by_*, then call click method.
from selenium import webdriver
# To prevent download dialog
profile = webdriver.FirefoxProfile()
profile.set_preference('browser.download.folderList', 2) # custom location
profile.set_preference('browser.download.manager.showWhenStarting', False)
profile.set_preference('browser.download.dir', '/tmp')
profile.set_preference('browser.helperApps.neverAsk.saveToDisk', 'text/csv')
browser = webdriver.Firefox(profile)
browser.get("http://www.drugcite.com/?q=ACTIMMUNE")
browser.find_element_by_id('exportpt').click()
browser.find_element_by_id('exporthlgt').click()
Added profile manipulation code to prevent download dialog.
I'll admit this solution is a little more "hacky" than the Firefox Profile saveToDisk alternative, but it works across both Chrome and Firefox, and doesn't rely on a browser-specific feature which could change at any time. And if nothing else, maybe this will give someone a little different perspective on how to solve future challenges.
Prerequisites: Ensure you have selenium and pyvirtualdisplay installed...
Python 2: sudo pip install selenium pyvirtualdisplay
Python 3: sudo pip3 install selenium pyvirtualdisplay
The Magic
import pyvirtualdisplay
import selenium
import selenium.webdriver
import time
import base64
import json
root_url = 'https://www.google.com'
download_url = 'https://www.google.com/images/branding/googlelogo/2x/googlelogo_color_272x92dp.png'
print('Opening virtual display')
display = pyvirtualdisplay.Display(visible=0, size=(1280, 1024,))
display.start()
print('\tDone')
print('Opening web browser')
driver = selenium.webdriver.Firefox()
#driver = selenium.webdriver.Chrome() # Alternately, give Chrome a try
print('\tDone')
print('Retrieving initial web page')
driver.get(root_url)
print('\tDone')
print('Injecting retrieval code into web page')
driver.execute_script("""
window.file_contents = null;
var xhr = new XMLHttpRequest();
xhr.responseType = 'blob';
xhr.onload = function() {
var reader = new FileReader();
reader.onloadend = function() {
window.file_contents = reader.result;
};
reader.readAsDataURL(xhr.response);
};
xhr.open('GET', %(download_url)s);
xhr.send();
""".replace('\r\n', ' ').replace('\r', ' ').replace('\n', ' ') % {
'download_url': json.dumps(download_url),
})
print('Looping until file is retrieved')
downloaded_file = None
while downloaded_file is None:
# Returns the file retrieved base64 encoded (perfect for downloading binary)
downloaded_file = driver.execute_script('return (window.file_contents !== null ? window.file_contents.split(\',\')[1] : null);')
print(downloaded_file)
if not downloaded_file:
print('\tNot downloaded, waiting...')
time.sleep(0.5)
print('\tDone')
print('Writing file to disk')
fp = open('google-logo.png', 'wb')
fp.write(base64.b64decode(downloaded_file))
fp.close()
print('\tDone')
driver.close() # close web browser, or it'll persist after python exits.
display.popen.kill() # close virtual display, or it'll persist after python exits.
Explaination
We first load a URL on the domain we're targeting a file download from. This allows us to perform an AJAX request on that domain, without running into cross site scripting issues.
Next, we're injecting some javascript into the DOM which fires off an AJAX request. Once the AJAX request returns a response, we take the response and load it into a FileReader object. From there we can extract the base64 encoded content of the file by calling readAsDataUrl(). We're then taking the base64 encoded content and appending it to window, a gobally accessible variable.
Finally, because the AJAX request is asynchronous, we enter a Python while loop waiting for the content to be appended to the window. Once it's appended, we decode the base64 content retrieved from the window and save it to a file.
This solution should work across all modern browsers supported by Selenium, and works whether text or binary, and across all mime types.
Alternate Approach
While I haven't tested this, Selenium does afford you the ability to wait until an element is present in the DOM. Rather than looping until a globally accessible variable is populated, you could create an element with a particular ID in the DOM and use the binding of that element as the trigger to retrieve the downloaded file.
In chrome what I do is downloading the files by clicking on the links, then I open chrome://downloads page and then retrieve the downloaded files list from shadow DOM like this:
docs = document
.querySelector('downloads-manager')
.shadowRoot.querySelector('#downloads-list')
.getElementsByTagName('downloads-item')
This solution is restrained to chrome, the data also contains information like file path and download date. (note this code is from JS, may not be the correct python syntax)
Here is the full working code. You can use web scraping to enter the username password and other field. For getting the field names appearing on the webpage, use inspect element. Element name(Username,Password or Click Button) can be entered through class or name.
from selenium import webdriver
# Using Chrome to access web
options = webdriver.ChromeOptions()
options.add_argument("download.default_directory=C:/Test") # Set the download Path
driver = webdriver.Chrome(options=options)
# Open the website
try:
driver.get('xxxx') # Your Website Address
password_box = driver.find_element_by_name('password')
password_box.send_keys('xxxx') #Password
download_button = driver.find_element_by_class_name('link_w_pass')
download_button.click()
driver.quit()
except:
driver.quit()
print("Faulty URL")

Categories