Find next missing number in list - python

I am trying to make a very simple login script to learn about accessing files and lists but I'm a bit stuck.
newaccno = str(1)
with open("C:\\Python\\Test\\userpasstest.txt","r+") as loginfile:
for line in loginfile.readlines():
line = line.strip()
logininfo = line.split(" ")
print(newaccno in logininfo[0])
while newaccno in logininfo[0]: #issue is here, also tried ==
newaccno += 1
print(newaccno)
loginfile.write(newaccno)
My logic is that it will search logininfo[0] for newaccno and if it is true, increase newaccno by 1 and search again until it is false then write to file (so if the file has 1, 2 and 3 already then newaccno will end up as 4).
Edit: This is how the txt file looks, the first number represents newaccno before it gets split.
1 abc qwe
2 123 456

(adapted from comment)
Your while loop needs to be inside your for loop for it to work. If it is outside logininfo[0] will always be the last line's first character

Related

line it up next to each other (nummbers)?

so i do not want the results under each other. How can i line it up next to each other? Like 1 1 1 and not 1 under 1 under 1. I did not find any good information about that. I tried print(x,t) but it do not work for for loops or does it?
here
By default, print() appends a newline character to the end of the string.
To have it not do this, simply use the following:
print("Hello World!", end = "")

python file output bugs

So I have to take the numbers from a certain file
containing:
1 5
2 300
3 3
9 155
7 73
7 0
Multiply them and add them to a new file
I used the script under here but for some reason, it now gives a syntax error.
f=open('multiply.txt')
f2=open('resulted.txt','w')
while True:
line=f.readline()
if len(line)==0:
break
line=line.strip()
result=line.split(" ")
multiply=int(result[0])*int(result[1])
multiply=str(multiply)
answer=print(result[0],"*",result[1],"=",multiply)
f2.write(str(multiply))
f.close()
f2.close()
i found out that f2.write(multiply) works
but i get all the answers as 1 string (5600913955110)
how do i get it to be 1 good text file and give the right calculation
Update:
f=open('multiply.txt')
f2=open('result.txt','w')
while True:
line=f.readline()
if len(line)==0:
break
line=line.strip()
result=line.split(" ")
multiply=int(result[0])*int(result[1])
multiply=str(multiply)
answer=print(result[0],"*",result[1],"=",multiply)
answer=str(answer)
f2.write(str(answer))
f2.write(str(multiply))
f.close()
f2.close()
output:
None5None600None9None1395None511None0
at the end of the code you have this line:
f2.write(str(answer)
notice there is not a ) at the end and you have two ( in the line.
try this:
f2.write(str(answer))
Also the name of the post sounds like its provoking opinion response. Try to change it so it doesn't mention your friend but the problem at hand.
In most programming languages, there are escape sequences. Escape sequences allow you to do many things. in your case you need to add the escape sequence
"\n"
this will add a new line onto each thing you append to the file.
like this:
answer=str(result[0])+"*"+str(result[1])+"="+str(multiply)
print(answer)
f2.write(str(answer)+"\n")

Interpreting a string received from a socket

I am trying to interpret a string that I have received from a socket. The first set of data is seen below:
2 -> 1
1 -> 2
2 -> 0
0 -> 2
0 -> 2
1 -> 2
2 -> 0
I am using the following code to get the numerical values:
for i in range(0,len(data)-1):
if data[i] == "-":
n1 = data[i-2]
n2 = data[i+3]
moves.append([int(n1),int(n2)])
But when a number greater than 9 appears in the data, the program only takes the second digit of that number (eg. with 10 the program would get 0). How would I get both of the digits from the code while maintaining the ability to get single digit numbers?
Well you just grab one character on each side ..
for the second value you can make it like this: data[i+3,len(data)-1]
for the first one: : data[0,i-2]
Use the split() function
numlist = data[i].split('->')
moves.append([int(numlist[0]),int(numlist[1])])
I assume each line is available as a (byte) string in a variable named line. If it's a whole bunch of lines then you can split it into individual lines with
lines = data.splitlines()
and work on each line inside a for statement:
for line in lines:
# do something with the line
If you are confident the lines will always be correctly formatted the easiest way to get the values you want uses the string split method. A full code starting from the data would then read like this.
lines = data.splitlines()
for line in lines:
first, _, second = line.split()
moves.append([int(first), int(second)])

Wit's end with file to dict

Python: 2.7.9
I erased all of my code because I'm going nuts.
Here's the gist (its for Rosalind challenge thingy):
I want to take a file that looks like this (no quotes on carets)
">"Rosalind_0304
actgatcgtcgctgtactcg
actcgactacgtagctacgtacgctgcatagt
">"Rosalind_2480
gctatcggtactgcgctgctacgtg
ccccccgaagaatagatag
">"Rosalind_2452
cgtacgatctagc
aaattcgcctcgaactcg
etc...
What I can't figure out how to do is basically everything at this point, my mind is so muddled. I'll just show kind of what I was doing, but failing to do.
1st. I want to search the file for '>'
Then assign the rest of that line into the dictionary as a key.
read the next lines up until the next '>' and do some calculations and return
findings into the value for that key.
go through the file and do it for every string.
then compare all values and return the key of whichever one is highest.
Can anyone help?
It might help if I just take a break. I've been coding all day and i think I smell colors.
def func(dna_str):
bla
return gcp #gc count percentage returned to the value in dict
With my_function somewhere that returns that percentage value:
with open('rosalind.txt', 'r') as ros:
rosa = {line[1:].split(' ')[0]:my_function(line.split(' ')[1].strip()) for line in ros if line.strip()}
top_key = max(rosa, key=rosa.get)
print(top_key, rosa.get(top_key))
For each line in the file, that will first check if there's anything left of the line after stripping trailing whitespace, then discard the blank lines. Next, it adds each non-blank line as an entry to a dictionary, with the key being everything to the left of the space except for the unneeded >, and the value being the result of sending everything to the right of the space to your function.
Then it saves the key corresponding to the highest value, then prints that key along with its corresponding value. You're left with a dictionary rosa that you can process however you like.
Complete code of the module:
def my_function(dna):
return 100 * len(dna.replace('A','').replace('T',''))/len(dna)
with open('rosalind.txt', 'r') as ros:
with open('rosalind_clean.txt', 'w') as output:
for line in ros:
if line.startswith('>'):
output.write('\n'+line.strip())
elif line.strip():
output.write(line.strip())
with open('rosalind_clean.txt', 'r') as ros:
rosa = {line[1:].split(' ')[0]:my_function(line.split(' ')[1].strip()) for line in ros if line.strip()}
top_key = max(rosa, key=rosa.get)
print(top_key, rosa.get(top_key))
Complete content of rosalind.txt:
>Rosalind_6404 CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCG
TTTCTCTGAGGCTTCCGGCCTTCCCTCCCACTAATAATTCTGAGG
>Rosalind_5959 CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCA
GGCGCTCCGCCGAAGGTCTATATCCA
TTTGTCAGCAGACACGC
>Rosalind_0808 CCACCCTCGTGGT
ATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGACTGGGAACCTGCGGGCAGTAGGTGGAAT
Result when running the module:
Rosalind_0808 60.91954022988506
This should properly handle an input file that doesn't necessarily have one entry per line.
See SO's formatting guide to learn how to make inline or block code tags to get past things like ">". If you want it to appear as regular text rather than code, escape the > with a backslash:
Type:
\>Rosalind
Result:
>Rosalind
I think I got that part down now. Thanks so much. BUUUUT. Its throwing an error about it.
rosa = {line[1:].split(' ')[0]:calc(line.split(' ')[1].strip()) for line in ros if line.strip()}
IndexError: list index out of range
this is my func btw.
def calc(dna_str):
for x in dna_str:
if x == 'G':
gc += 1
divc += 1
elif x == 'C':
gc += 1
divc += 1
else:
divc += 1
gcp = float(gc/divc)
return gcp
Exact test file. no blank lines before or after.
>Rosalind_6404
CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC
TCCCACTAATAATTCTGAGG
>Rosalind_5959
CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT
ATATCCATTTGTCAGCAGACACGC
>Rosalind_0808
CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC
TGGGAACCTGCGGGCAGTAGGTGGAAT

finding and replacing a string within a line with an if statement

I am trying to parse a particular text file. I am trying to open the text file and line by line ask if a particular string is there (In the following example case its the presence of the number 01 in the curly brackets), then manipulate a particular string either forwards backwards, or keep it the same. Here's that example, with one line named arbitrarily "go"... (other lines in the full file have similar format but have {01}, {00} etc...
go = 'USC_45774-1111-0 <hkxhk> {10} ; 78'
go = go.replace(go[22:24],go[23:21:-1])
>>> go
'USC_45774-1111-0 <khxkh> {10} ; 78'
I am trying to manipulate the first "hk" (go[22:24]) by replacing it with the same letters but backwards (go[23:21:-1).What I want is to see khxhk but as you can see, the result I am getting is that both are turned backwards to khxkh.
I am also having a problem of executing the specific if statement for each line. Many lines that dont have {01} are being manipulated as if they were....
with open('c:/LG 1A.txt', 'r') as rfp:
with open('C:/output5.txt', 'w') as wfp:
for line in rfp.readlines():
if "{01}" or "{-1}" in line:
line = line.replace(line[25:27],line[26:24:-1])
line = line.replace("<"," ")
line = line.replace(">"," ")
line = line.replace("x"," ")
wfp.write(line)
elif "{10}" or "{1-}" in line:
line = line.replace(line[22:24],line[23:21:-1])
line = line.replace("<"," ")
line = line.replace(">"," ")
line = line.replace("x"," ")
wfp.write(line)
elif "{11}" in line:
line = line.replace(line[22:27],line[26:21:-1])
line = line.replace("<"," ")
line = line.replace(">"," ")
line = line.replace("x"," ")
wfp.write(line)
wfp.close()
Am I missing something simple?
The string replace method does not replace characters by position, it replaces them by what characters they are.
>>> 'apple aardvark'.replace('a', '!')
'!pple !!rdv!rk'
So in your first case, you are telling to replace "hk" with "kh". It doesn't "know" that you want to only replace one of the occurrences; it just knows you want to replace "hk" with "kh", so it replaces all occurrences.
You can use the count argument to replace to specify that you only want to replace the first occurrence:
>>> go = 'USC_45774-1111-0 <hkxhk> {10} ; 78'
... go.replace(go[22:24],go[23:21:-1],1)
'USC_45774-1111-0 <khxhk> {10} ; 78'
Note, though, that this will always replace the first occurrence, not necessarily the occurrence at the position in the string you specified. In this case I guess that's what you want, but it may not work directly for other similar tasks. (That is, there is no way to use this method as-is to replace the second occurrence or the third occurrence; you can only replace the first, or the first two, or the first three, etc. To replace the second or third occurrence you'd need to do a bit more.)
As for the second part of your question, you are misunderstanding what if "{01}" or "{-1}" in line means. It means, in layman's terms, if "{01}" or if "{-1}" in line. Since if "{01}" is always true (i.e., the string "{01}" is not a false value), the whole condition is always true. What you want is if "{01}" in line or "{-1}" in line".
I don't know what it is about Python, but your problem is one that gets posted here at least a couple times every day.
if "{01}" or "{-1}" in line:
This doesn't do what you think it does. It asks, "is "{01}" true"? Because it's a non-zero-length string, it is. Because or short-circuits, the rest of the condition is not tested because the first argument is true. Therefore the body of your if statement is always executed.
In other words, Python evaluates as if you'd written this:
if ("{01}") or ("{-1}" in line):
You want something like:
if "{01}" in line or "{-1}" in line:
Or if you have a lot of similar conditions:
if any(x in line for x in ("{01}", "{-1}")):
you can use count argument of replace():
'USC_45774-1111-0 <hkxhk> {10} ; 78'.replace("hk","kh",1)
For your second question, you need change the condition to:
if "{01}" in line or "{-1}" in line:
...

Categories