numpy reshape and tile - python

I am trying to convert a vector from A-L to something like this with pandas and numpy built in functions without loops (tile, repeat and reshape). But I cannot wrap my head around
0 1 2 3 4 5 6 7 8 9 10 11
0 A A A A E E E E I I I I
1 B B B B F F F F J J J J
2 C C C C G G G G K K K K
3 D D D D H H H H L L L L
4 A A A A E E E E I I I I
5 B B B B F F F F J J J J
6 C C C C G G G G K K K K
7 D D D D H H H H L L L L
Do you have any ideas how I could do that without loops ?
what I have tried so far:
a = np.array(['A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L'])
b = a.reshape(3,4)
np.repeat(b, 4).reshape(4,12)
gives me:
array([['A', 'A', 'A', 'A', 'B', 'B', 'B', 'B', 'C', 'C', 'C', 'C'],
['D', 'D', 'D', 'D', 'E', 'E', 'E', 'E', 'F', 'F', 'F', 'F'],
['G', 'G', 'G', 'G', 'H', 'H', 'H', 'H', 'I', 'I', 'I', 'I'],
['J', 'J', 'J', 'J', 'K', 'K', 'K', 'K', 'L', 'L', 'L', 'L']],
dtype='<U1')
EDIT: Some background. Depending on the number of samples and the layout we choose. A machine, creates plates (like in this image). We can do consecutive operations (add more chemicals etc.) and based on the previous layout, unique combinations are obtained. Afterwards the machine measures e.g. concentration in each well and I would like to link the output to the conditions in each well. Because the machine can measure e.g. concentration after each step, a lot of data can be generated and I am trying to find a generic solution without too many loops.

You could use:
>>> import numpy as np
>>> x = np.array(list('abcdefghijkl'.upper())) # your "vector"
>>> np.repeat(np.tile(x.reshape(-1, 4), 2).T, 4, axis=1)
array([['A', 'A', 'A', 'A', 'E', 'E', 'E', 'E', 'I', 'I', 'I', 'I'],
['B', 'B', 'B', 'B', 'F', 'F', 'F', 'F', 'J', 'J', 'J', 'J'],
['C', 'C', 'C', 'C', 'G', 'G', 'G', 'G', 'K', 'K', 'K', 'K'],
['D', 'D', 'D', 'D', 'H', 'H', 'H', 'H', 'L', 'L', 'L', 'L'],
['A', 'A', 'A', 'A', 'E', 'E', 'E', 'E', 'I', 'I', 'I', 'I'],
['B', 'B', 'B', 'B', 'F', 'F', 'F', 'F', 'J', 'J', 'J', 'J'],
['C', 'C', 'C', 'C', 'G', 'G', 'G', 'G', 'K', 'K', 'K', 'K'],
['D', 'D', 'D', 'D', 'H', 'H', 'H', 'H', 'L', 'L', 'L', 'L']],
dtype='<U1')
It first reshapes it so that you have 4 characters in each column, then duplicates them. Then you transpose it so you have the correct rows/columns and finally you just repeat every character 4 times.
Step-by-step it looks like this:
>>> import pandas as pd
>>> x
array(['A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L'],
dtype='<U1')
>>> x.reshape(-1, 4)
array([['A', 'B', 'C', 'D'],
['E', 'F', 'G', 'H'],
['I', 'J', 'K', 'L']],
dtype='<U1')
>>> np.tile(_, 2)
array([['A', 'B', 'C', 'D', 'A', 'B', 'C', 'D'],
['E', 'F', 'G', 'H', 'E', 'F', 'G', 'H'],
['I', 'J', 'K', 'L', 'I', 'J', 'K', 'L']],
dtype='<U1')
>>> _.T
array([['A', 'E', 'I'],
['B', 'F', 'J'],
['C', 'G', 'K'],
['D', 'H', 'L'],
['A', 'E', 'I'],
['B', 'F', 'J'],
['C', 'G', 'K'],
['D', 'H', 'L']],
dtype='<U1')
>>> np.repeat(_, 4, axis=1)
array([['A', 'A', 'A', 'A', 'E', 'E', 'E', 'E', 'I', 'I', 'I', 'I'],
['B', 'B', 'B', 'B', 'F', 'F', 'F', 'F', 'J', 'J', 'J', 'J'],
['C', 'C', 'C', 'C', 'G', 'G', 'G', 'G', 'K', 'K', 'K', 'K'],
['D', 'D', 'D', 'D', 'H', 'H', 'H', 'H', 'L', 'L', 'L', 'L'],
['A', 'A', 'A', 'A', 'E', 'E', 'E', 'E', 'I', 'I', 'I', 'I'],
['B', 'B', 'B', 'B', 'F', 'F', 'F', 'F', 'J', 'J', 'J', 'J'],
['C', 'C', 'C', 'C', 'G', 'G', 'G', 'G', 'K', 'K', 'K', 'K'],
['D', 'D', 'D', 'D', 'H', 'H', 'H', 'H', 'L', 'L', 'L', 'L']],
dtype='<U1')
>>> pd.DataFrame(_)
0 1 2 3 4 5 6 7 8 9 10 11
0 A A A A E E E E I I I I
1 B B B B F F F F J J J J
2 C C C C G G G G K K K K
3 D D D D H H H H L L L L
4 A A A A E E E E I I I I
5 B B B B F F F F J J J J
6 C C C C G G G G K K K K
7 D D D D H H H H L L L L

a = np.array(list("ABCDEFGHIJKL"))
a
# array(['A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L'],
# dtype='<U1')
np.repeat(np.tile(a.reshape(3,4), 2).T, 4, axis=1)
#array([['A', 'A', 'A', 'A', 'E', 'E', 'E', 'E', 'I', 'I', 'I', 'I'],
# ['B', 'B', 'B', 'B', 'F', 'F', 'F', 'F', 'J', 'J', 'J', 'J'],
# ['C', 'C', 'C', 'C', 'G', 'G', 'G', 'G', 'K', 'K', 'K', 'K'],
# ['D', 'D', 'D', 'D', 'H', 'H', 'H', 'H', 'L', 'L', 'L', 'L'],
# ['A', 'A', 'A', 'A', 'E', 'E', 'E', 'E', 'I', 'I', 'I', 'I'],
# ['B', 'B', 'B', 'B', 'F', 'F', 'F', 'F', 'J', 'J', 'J', 'J'],
# ['C', 'C', 'C', 'C', 'G', 'G', 'G', 'G', 'K', 'K', 'K', 'K'],
# ['D', 'D', 'D', 'D', 'H', 'H', 'H', 'H', 'L', 'L', 'L', 'L']],
# dtype='<U1')

Related

Python - Creating permutations with output array index constraints

I want to create all possible permutations for an array in which each element can only occur once, with constraints on the element array index position.
ID = ["A","B","C","D","E","F","G","H","I","J"]
I want to create all possible permutations of the original_array, however the positions of each element are restricted to index positions given by:
ID = ["A","B","C","D","E","F","G","H","I","J"]
Index_Options=[]
for i in range(len(ID)):
List1=[]
distance=3
value = i - distance
for j in range((int(distance)*2)):
if value < 0 or value > len(ID):
print("Disregard") #Outside acceptable distance range
else:
List1.append(value)
value=value+1
Index_Options.append(List1)
print(Index_Options)
#Index_Options gives the possible index positions for each element. ie "A" can occur in only index positions 0,1,2, "B" can occur in only index positions 0,1,2,3 ect.
I'm just struggling on how to then use this information to create all the output permutations.
Any help would be appreciated
You can use a recursive generator function to build the combinations. Instead of generating all possible permutations from ID and then filtering based on Index_Options, it is much more efficient to produce a cartesian product of ID by directly traversing Index_Options:
ID = ["A","B","C","D","E","F","G","H","I","J"]
def combos(d, c = [], s = []):
if not d:
yield c
else:
for i in filter(lambda x:x not in s and x < len(ID), d[0]):
yield from combos(d[1:], c=c+[ID[i]], s=s+[i])
print(list(combos(Index_Options)))
Output (first ten combinations produced):
[['A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J'], ['A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'J', 'I'], ['A', 'B', 'C', 'D', 'E', 'F', 'G', 'I', 'H', 'J'], ['A', 'B', 'C', 'D', 'E', 'F', 'G', 'I', 'J', 'H'], ['A', 'B', 'C', 'D', 'E', 'F', 'G', 'J', 'H', 'I'], ['A', 'B', 'C', 'D', 'E', 'F', 'G', 'J', 'I', 'H'], ['A', 'B', 'C', 'D', 'E', 'F', 'H', 'G', 'I', 'J'], ['A', 'B', 'C', 'D', 'E', 'F', 'H', 'G', 'J', 'I'], ['A', 'B', 'C', 'D', 'E', 'F', 'H', 'I', 'G', 'J'], ['A', 'B', 'C', 'D', 'E', 'F', 'H', 'I', 'J', 'G']]
You can use itertools.permutations to create all the possible permutations and then create new list with a check if all the letters are in the correct position
permutations = [p for p in itertools.permutations(ID, len(ID)) if all(i in Index_Options[ID.index(x)] for i, x in enumerate(p))]

How to split/slice a list in Python

I saw this code in w3resource:
C = ['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n']
def list_slice(S, step):
return [S[i::step] for i in range(step)]
print(list_slice(C,3))
Output :[['a', 'd', 'g', 'j', 'm'], ['b', 'e', 'h', 'k', 'n'], ['c', 'f', 'i', 'l']]
I tried it without list comprehension and a function:
letters = ['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n']
step = int(input("Step of every element: "))
for i in range(step):
print(letters[i::step])
Output:
['a', 'd', 'g', 'j', 'm']
['b', 'e', 'h', 'k', 'n']
['c', 'f', 'i', 'l']
is it possible to make my output like this [['a', 'd', 'g', 'j', 'm'], ['b', 'e', 'h', 'k', 'n'], ['c', 'f', 'i', 'l']] without using list comprehension and without making another variable with an empty list?
not a list comprehension solution, but since you want an element having certain distance/step in the list to be in the same list, then you can see that those element index share single property altogether which have the same remainder to the step value, using this approach you can save those value for that index remainder in a key-value pair of dict and in result you can take the values which are nonempty.
C = ['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n']
def func(lis, slic):
res = {i:[] for i in range(len(lis)//slic)}
for i in range(len(lis)):
res[i%slic].append(lis[i])
return [i for i in res.values() if i!=[]]
print(func(C, 3))
# Output :[['a', 'd', 'g', 'j', 'm'], ['b', 'e', 'h', 'k', 'n'], ['c', 'f', 'i', 'l']]

return list pair (print out) from 2 list of same length

I have 2 lists (x and y) and I want to output in x, y (just the print out). May I know how to do it? Do I need a loop to loop through each item in the x and y list?
input :
x = [['A', 'B'], ['C', 'D'], ['F', 'G']]
y = [['L', 'M'], ['J', 'K'], ['O', 'P', 'Q']]
output :
x, y format
['A', 'B'] ['L', 'M']
['C', 'D'] ['J', 'K']
['F', 'G'] ['O', 'P', 'Q']
The closest I got is as below :
for row in x:
n = []
for loop in y :
for x in loop :
n.append(x)
print(' '.join(row).strip().split()) , n
Output :
['A', 'B'] ['L', 'M']
['A', 'B'] ['L', 'M', 'J', 'K']
['A', 'B'] ['L', 'M', 'J', 'K', 'O', 'P', 'Q']
['C', 'D'] ['L', 'M']
['C', 'D'] ['L', 'M', 'J', 'K']
['C', 'D'] ['L', 'M', 'J', 'K', 'O', 'P', 'Q']
['F', 'G'] ['L', 'M']
['F', 'G'] ['L', 'M', 'J', 'K']
['F', 'G'] ['L', 'M', 'J', 'K', 'O', 'P', 'Q']
You can use zip to make tuples of elements of your lists:
list(zip(x, y))
Produces:
[(['A', 'B'], ['L', 'M']),
(['C', 'D'], ['J', 'K']),
(['F', 'G'], ['O', 'P', 'Q'])]
The resulting list is, in this example, of length 3. The first element is:
>>> list(zip(x, y))[0]
(['A', 'B'], ['L', 'M'])
In order to print the tuples with a space in between:
for a, b in zip(x, y):
print(f'{a} {b}')
Output:
['A', 'B'] ['L', 'M']
['C', 'D'] ['J', 'K']
['F', 'G'] ['O', 'P', 'Q']

Split every character from string in list

I have a list and I need to split every string into individual characters.
mylist = ['TCTAGTCCAGATAATCTGGT', 'GTGTTGGTACTGTAATGAAA', 'AGTTCTCTGGATCCTTCGGA', 'GGAATTGACGTCCCCAGGAA', 'GTCGTTGTCGTTCAGGAGTT', 'GGAGTCCGTCAGAAGAGGTC', 'GATTCCGATCAGATGAAGAA', 'CTTTCTATCGGGAAGAGGAG', 'ATGTCTTGAGATCGGGTCGT', 'ATTAAGATCCTCCATGATTC', 'ATCGTCGAAAGTAGTGGGAA']
And I need
output = ['T', 'C', 'T', ... 'A', 'A']
If tried so many ways and can't figure it out.
You can just use embedded list comprehension for this.
mylist = ['TCTAGTCCAGATAATCTGGT', 'GTGTTGGTACTGTAATGAAA', 'AGTTCTCTGGATCCTTCGGA', 'GGAATTGACGTCCCCAGGAA', 'GTCGTTGTCGTTCAGGAGTT', 'GGAGTCCGTCAGAAGAGGTC', 'GATTCCGATCAGATGAAGAA', 'CTTTCTATCGGGAAGAGGAG', 'ATGTCTTGAGATCGGGTCGT', 'ATTAAGATCCTCCATGATTC', 'ATCGTCGAAAGTAGTGGGAA']
chars = [c for s in mylist for c in s]
print(chars)
# ['T', 'C', 'T', 'A', 'G', 'T', 'C', 'C', 'A', 'G', 'A', 'T', 'A', 'A', 'T', 'C', 'T', 'G', 'G', 'T', 'G', 'T', 'G', 'T', 'T', 'G', 'G', 'T', 'A', 'C', 'T', 'G', 'T', 'A', 'A', 'T', 'G', 'A', 'A', 'A', 'A', 'G', 'T', 'T', 'C', 'T', 'C', 'T', 'G', 'G', 'A', 'T', 'C', 'C', 'T', 'T', 'C', 'G', 'G', 'A', 'G', 'G', 'A', 'A', 'T', 'T', 'G', 'A', 'C', 'G', 'T', 'C', 'C', 'C', 'C', 'A', 'G', 'G', 'A', 'A', 'G', 'T', 'C', 'G', 'T', 'T', 'G', 'T', 'C', 'G', 'T', 'T', 'C', 'A', 'G', 'G', 'A', 'G', 'T', 'T', 'G', 'G', 'A', 'G', 'T', 'C', 'C', 'G', 'T', 'C', 'A', 'G', 'A', 'A', 'G', 'A', 'G', 'G', 'T', 'C', 'G', 'A', 'T', 'T', 'C', 'C', 'G', 'A', 'T', 'C', 'A', 'G', 'A', 'T', 'G', 'A', 'A', 'G', 'A', 'A', 'C', 'T', 'T', 'T', 'C', 'T', 'A', 'T', 'C', 'G', 'G', 'G', 'A', 'A', 'G', 'A', 'G', 'G', 'A', 'G', 'A', 'T', 'G', 'T', 'C', 'T', 'T', 'G', 'A', 'G', 'A', 'T', 'C', 'G', 'G', 'G', 'T', 'C', 'G', 'T', 'A', 'T', 'T', 'A', 'A', 'G', 'A', 'T', 'C', 'C', 'T', 'C', 'C', 'A', 'T', 'G', 'A', 'T', 'T', 'C', 'A', 'T', 'C', 'G', 'T', 'C', 'G', 'A', 'A', 'A', 'G', 'T', 'A', 'G', 'T', 'G', 'G', 'G', 'A', 'A']
you can use a list comprehension to create new sub lists where each char is split.
mylist = ['TCTAGTCCAGATAATCTGGT', 'GTGTTGGTACTGTAATGAAA', 'AGTTCTCTGGATCCTTCGGA', 'GGAATTGACGTCCCCAGGAA', 'GTCGTTGTCGTTCAGGAGTT', 'GGAGTCCGTCAGAAGAGGTC', 'GATTCCGATCAGATGAAGAA', 'CTTTCTATCGGGAAGAGGAG', 'ATGTCTTGAGATCGGGTCGT', 'ATTAAGATCCTCCATGATTC', 'ATCGTCGAAAGTAGTGGGAA']
my_split_list = [[char for char in element] for element in mylist]
print(mylist)
print(my_split_list)
OUTPUT
['TCTAGTCCAGATAATCTGGT', 'GTGTTGGTACTGTAATGAAA', 'AGTTCTCTGGATCCTTCGGA', 'GGAATTGACGTCCCCAGGAA', 'GTCGTTGTCGTTCAGGAGTT', 'GGAGTCCGTCAGAAGAGGTC', 'GATTCCGATCAGATGAAGAA', 'CTTTCTATCGGGAAGAGGAG', 'ATGTCTTGAGATCGGGTCGT', 'ATTAAGATCCTCCATGATTC', 'ATCGTCGAAAGTAGTGGGAA']
[['T', 'C', 'T', 'A', 'G', 'T', 'C', 'C', 'A', 'G', 'A', 'T', 'A', 'A', 'T', 'C', 'T', 'G', 'G', 'T'], ['G', 'T', 'G', 'T', 'T', 'G', 'G', 'T', 'A', 'C', 'T', 'G', 'T', 'A', 'A', 'T', 'G', 'A', 'A', 'A'], ['A', 'G', 'T', 'T', 'C', 'T', 'C', 'T', 'G', 'G', 'A', 'T', 'C', 'C', 'T', 'T', 'C', 'G', 'G', 'A'], ['G', 'G', 'A', 'A', 'T', 'T', 'G', 'A', 'C', 'G', 'T', 'C', 'C', 'C', 'C', 'A', 'G', 'G', 'A', 'A'], ['G', 'T', 'C', 'G', 'T', 'T', 'G', 'T', 'C', 'G', 'T', 'T', 'C', 'A', 'G', 'G', 'A', 'G', 'T', 'T'], ['G', 'G', 'A', 'G', 'T', 'C', 'C', 'G', 'T', 'C', 'A', 'G', 'A', 'A', 'G', 'A', 'G', 'G', 'T', 'C'], ['G', 'A', 'T', 'T', 'C', 'C', 'G', 'A', 'T', 'C', 'A', 'G', 'A', 'T', 'G', 'A', 'A', 'G', 'A', 'A'], ['C', 'T', 'T', 'T', 'C', 'T', 'A', 'T', 'C', 'G', 'G', 'G', 'A', 'A', 'G', 'A', 'G', 'G', 'A', 'G'], ['A', 'T', 'G', 'T', 'C', 'T', 'T', 'G', 'A', 'G', 'A', 'T', 'C', 'G', 'G', 'G', 'T', 'C', 'G', 'T'], ['A', 'T', 'T', 'A', 'A', 'G', 'A', 'T', 'C', 'C', 'T', 'C', 'C', 'A', 'T', 'G', 'A', 'T', 'T', 'C'], ['A', 'T', 'C', 'G', 'T', 'C', 'G', 'A', 'A', 'A', 'G', 'T', 'A', 'G', 'T', 'G', 'G', 'G', 'A', 'A']]

NetworkX shuffles nodes order

I'm beginner to programming and I'm new here, so hello!
I'm having a problem with nodes order in networkX.
This code:
letters = []
G = nx.Graph()
for i in range(nodesNum):
letter = ascii_lowercase[i]
letters.append(letter)
print letters
G.add_nodes_from(letters)
print "G.nodes = ", (G.nodes())
returns this:
['a']
['a', 'b']
['a', 'b', 'c']
['a', 'b', 'c', 'd']
['a', 'b', 'c', 'd', 'e']
['a', 'b', 'c', 'd', 'e', 'f']
['a', 'b', 'c', 'd', 'e', 'f', 'g']
['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h']
['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i']
['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j']
G.nodes = ['a', 'c', 'b', 'e', 'd', 'g', 'f', 'i', 'h', 'j']
While I would like to have it in normal (alphabetical) order.
Could anyone tell me what am I doing wrong?
The order is important to me, as later I'm asking user to tell me where the edges are.
Thanks in advance!
You can sort the nodes on output like this
print "G.nodes = ", sorted(G.nodes())
or similarly you can sort the edges like
print "G.edges = ", sorted(G.edges())
Aric's solution would do fine if you want to use this for printing only. However if you are going to use adjacent matrix for calculations and you want consistent matrices in different runs, you should do:
letters = []
G = nx.OrderedGraph()
for i in range(10):
letter = ['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j'][i]
letters.append(letter)
print (letters)
G.add_nodes_from(letters)
print ("G.nodes = ", (G.nodes()))
which returns
['a']
['a', 'b']
['a', 'b', 'c']
['a', 'b', 'c', 'd']
['a', 'b', 'c', 'd', 'e']
['a', 'b', 'c', 'd', 'e', 'f']
['a', 'b', 'c', 'd', 'e', 'f', 'g']
['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h']
['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i']
['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j']
G.nodes = ['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j']

Categories