We Keep Coding

How to match and replace this pattern in Python RE?

s = "[abc]abx[abc]b"
s = re.sub("\[([^\]]*)\]a", "ABC", s)
'ABCbx[abc]b'
In the string, s, I want to match 'abc' when it's enclosed in [], and followed by a 'a'. So in that string, the first [abc] will be replaced, and the second won't.
I wrote the pattern above, it matches:
match anything starting with a '[', followed by any number of characters which is not ']', then followed by the character 'a'.
However, in the replacement, I want the string to be like:
[ABC]abx[abc]b . // NOT ABCbx[abc]b
Namely, I don't want the whole matched pattern to be replaced, but only anything with the bracket []. How to achieve that?
match.group(1) will return the content in []. But how to take advantage of this in re.sub?

Why not simply include [ and ] in the substitution?
s = re.sub("\[([^\]]*)\]a", "[ABC]a", s)

There exist more than 1 method, one of them is exploting groups.
import re
s = "[abc]abx[abc]b"
out = re.sub('(\[)([^\]]*)(\]a)', r'\1ABC\3', s)
print(out)
Output:
[ABC]abx[abc]b
Note that there are 3 groups (enclosed in brackets) in first argument of re.sub, then I refer to 1st and 3rd (note indexing starts at 1) so they remain unchanged, instead of 2nd group I put ABC. Second argument of re.sub is raw string, so I do not need to escape \.

This regex uses lookarounds for the prefix/suffix assertions, so that the match text itself is only "abc":
(?<=\[)[^]]*(?=\]a)
Example: https://regex101.com/r/NDlhZf/1
So that's:
(?<=\[) - positive look-behind, asserting that a literal [ is directly before the start of the match
[^]]* - any number of non-] characters (the actual match)
(?=\]a) - positive look-ahead, asserting that the text ]a directly follows the match text.

Match everything except a pattern and replace matched with string

I want to use python in order to manipulate a string I have.
Basically, I want to prepend"\x" before every hex byte except the bytes that already have "\x" prepended to them.
My original string looks like this:
mystr = r"30336237613131\x90\x01\x0A\x90\x02\x146F6D6D616E64\x90\x01\x06\x90\x02\x0F52656C6174\x90\x01\x02\x90\x02\x50656D31\x90\x00"
And I want to create the following string from it:
mystr = r"\x30\x33\x62\x37\x61\x31\x31\x90\x01\x0A\x90\x02\x14\x6F\x6D\x6D\x61\x6E\x64\x90\x01\x06\x90\x02\x0F\x52\x65\x6C\x61\x74\x90\x01\x02\x90\x02\x50\x65\x6D\x31\x90\x00"
I thought of using regular expressions to match everything except /\x../g and replace every match with "\x". Sadly, I struggled with it a lot without any success. Moreover, I'm not sure that using regex is the best approach to solve such case.

Regex: (?:\\x)?([0-9A-Z]{2}) Substitution: \\x$1
Details:
(?:) Non-capturing group
? Matches between zero and one time, match string \x if it exists.
() Capturing group
[] Match a single character present in the list 0-9 and A-Z
{n} Matches exactly n times
\\x String \x
$1 Group 1.
Python code:
import re
text = R'30336237613131\x90\x01\x0A\x90\x02\x146F6D6D616E64\x90\x01\x06\x90\x02\x0F52656C6174\x90\x01\x02\x90\x02\x50656D31\x90\x00'
text = re.sub(R'(?:\\x)?([0-9A-Z]{2})', R'\\x\1', text)
print(text)
Output:
\x30\x33\x62\x37\x61\x31\x31\x90\x01\x0A\x90\x02\x14\x6F\x6D\x6D\x61\x6E\x64\x90\x01\x06\x90\x02\x0F\x52\x65\x6C\x61\x74\x90\x01\x02\x90\x02\x50\x65\x6D\x31\x90\x00
Code demo

You don't need regex for this. You can use simple string manipulation. First remove all of the "\x" from your string. Then add add it back at every 2 characters.
replaced = mystr.replace(r"\x", "")
newstr = "".join([r"\x" + replaced[i*2:(i+1)*2] for i in range(len(replaced)/2)])
Output:
>>> print(newstr)
\x30\x33\x62\x37\x61\x31\x31\x90\x01\x0A\x90\x02\x14\x6F\x6D\x6D\x61\x6E\x64\x90\x01\x06\x90\x02\x0F\x52\x65\x6C\x61\x74\x90\x01\x02\x90\x02\x50\x65\x6D\x31\x90\x00

You can get a list with your values to manipulate as you wish, with an even simpler re pattern
mystr = r"30336237613131\x90\x01\x0A\x90\x02\x146F6D6D616E64\x90\x01\x06\x90\x02\x0F52656C6174\x90\x01\x02\x90\x02\x50656D31\x90\x00"
import re
pat = r'([a-fA-F0-9]{2})'
match = re.findall(pat, mystr)
if match:
print('\n\nNew string:')
print('\\x' + '\\x'.join(match))
#for elem in match: # match gives you a list of strings with the hex values
# print('\\x{}'.format(elem), end='')
print('\n\nOriginal string:')
print(mystr)

This can be done without replacing existing \x by using a combination of positive lookbehinds and negative lookaheads.
(?!(?<=\\x)|(?<=\\x[a-f\d]))([a-f\d]{2})
Usage
See code in use here
import re
regex = r"(?!(?<=\\x)|(?<=\\x[a-f\d]))([a-f\d]{2})"
test_str = r"30336237613131\x90\x01\x0A\x90\x02\x146F6D6D616E64\x90\x01\x06\x90\x02\x0F52656C6174\x90\x01\x02\x90\x02\x50656D31\x90\x00"
subst = r"\\x$1"
result = re.sub(regex, subst, test_str, 0, re.IGNORECASE)
if result:
print (result)
Explanation
(?!(?<=\\x)|(?<=\\x[a-f\d])) Negative lookahead ensuring either of the following doesn't match.
(?<=\\x) Positive lookbehind ensuring what precedes is \x.
(?<=\\x[a-f\d]) Positive lookbehind ensuring what precedes is \x followed by a hexidecimal digit.
([a-f\d]{2}) Capture any two hexidecimal digits into capture group 1.

python3: regex, find all substrings that starts with and end with certain string

Let's say that I have a string that looks like this:
a = '1253abcd4567efgh8910ijkl'
I want to find all substrings that starts with a digit, and ends with an alphabet.
I tried,
b = re.findall('\d.*\w',a)
but this gives me,
['1253abcd4567efgh8910ijkl']
I want to have something like,
['1234abcd','4567efgh','8910ijkl']
How can I do this? I'm pretty new to regex method, and would really appreciate it if anyone can show how to do this in different method within regex, and explain what's going on.

\w will match any wordcharacter which consists of numbers, alphabets and the underscore sign. You need to use [a-zA-Z] to capture letters only. See this example.
import re
a = '1253abcd4567efgh8910ijkl'
b = re.findall('(\d+[A-Za-z]+)',a)
Output:
['1253abcd', '4567efgh', '8910ijkl']
\d will match digits. \d+ will match one or more consecutive digits. For e.g.
>>> re.findall('(\d+)',a)
['1253', '4567', '8910']
Similarly [a-zA-Z]+ will match one or more alphabets.
>>> re.findall('([a-zA-Z]+)',a)
['abcd', 'efgh', 'ijkl']
Now put them together to match what you exactly want.

From the Python manual on regular expressions, it tells us that \w:
matches any alphanumeric character and the underscore; this is equivalent to the set [a-zA-Z0-9_]
So you are actually over capturing what you need. Refine your regular expression a bit:
>>> re.findall(r'(\d+[a-z]+)', a, re.I)
['1253abcd', '4567efgh', '8910ijkl']
The re.I makes your expression case insensitive, so it will match upper and lower case letters as well:
>>> re.findall(r'(\d+[a-z]+)', '12124adbad13434AGDFDF434348888AAA')
['12124adbad']
>>> re.findall(r'(\d+[a-z]+)', '12124adbad13434AGDFDF434348888AAA', re.I)
['12124adbad', '13434AGDFDF', '434348888AAA']

\w matches string with any alphanumeric character. And you have used \w with *. So your code will provide a string which is starting with a digit and contains alphanumeric characters of any length.
Solution:
>>>b=re.findall('\d*[A-Za-z]*', a)
>>>b
['1253abcd', '4567efgh', '8910ijkl', '']
you will get '' (an empty string) at the end of the list to display no match. You can remove it using
b.pop(-1)

split string in python when characters on either side of separator are not numbers

I have a large list of chemical data, that contains entries like the following:
1. 2,4-D, Benzo(a)pyrene, Dioxin, PCP, 2,4,5-TP
2. Lead,Paints/Pigments,Zinc
I have a function that is correctly splitting the 1st entry into:
['2,4-D', 'Benzo(a)pyrene', 'Dioxin', 'PCP', '2,4,5-TP']
based on ', ' as a separator. For the second entry, ', ' won't work. But, if i could easily split any string that contains ',' with only two non-numeric characters on either side, I would be able to parse all entries like the second one, without splitting up the chemicals in entries like the first, that have numbers in their name separated by commas (i.e. 2,4,5-TP).
Is there an easy pythonic way to do this?

I explain a little bit based on #eph's answer:
import re
data_list = ['2,4-D, Benzo(a)pyrene, Dioxin, PCP, 2,4,5-TP', 'Lead,Paints/Pigments,Zinc']
for d in data_list:
print re.split(r'(?<=\D),\s*|\s*,(?=\D)',d)
re.split(pattern, string) will split string by the occurrences of regex pattern.
(plz read Regex Quick Start if you are not familiar with regex.)
The (?<=\D),\s*|\s*,(?=\D) consists of two part: (?<=\D),\s* and \s*,(?=\D). The meaning of each unit:
The middle | is the OR operator.
\D matches a single character that is not a digit.
\s matches a whitespace character (includes tabs and line breaks).
, matches character ",".
* attempts to match the preceding token zero or more times. Therefore, \s* means the whitespace can be appear zero or more times. (see Repetition with Star and Plus)
(?<= ... ) and (?= ...) are the lookbebind and lookahead assertions.
For example, q(?=u) matches a q that is followed by a u, without making the u part of the match.
Therefore, \s*,(?=\D) matches a , that is preceded by zero or more whitespace and followed by non-digit characters. Similarly, (?<=\D),\s* matches a , that is preceded by non-digit characters and followed by zero or more whitespace. The whole regex will find , that satisfy either case, which is equivalent to your requirement: ',' with only two non-numeric characters on either side.
Some useful tools for regex:
Regex Cheat Sheet
Online regex tester: regex101 (with a tree structure explanation to your regex)

Use regex and lookbehind/lookahead assertion
>>> re.split(r'(?<=\D\D),\s*|,\s*(?=\D\D)', s)
['2,4-D', 'Benzo(a)pyrene', 'Dioxin', 'PCP', '2,4,5-TP']

>>> s1 = "2,4-D, Benzo(a)pyrene, Dioxin, PCP, 2,4,5-TP"
>>> s2 = "Lead,Paints/Pigments,Zinc"
>>> import re
>>> res1 = re.findall(r"\s*(.*?[A-Za-z])(?:,|$)", s1)
>>> res1
['2,4-D', 'Benzo(a)pyrene', 'Dioxin', 'PCP', '2,4,5-TP']
>>> res2 = re.findall(r"\s*(.*?[A-Za-z])(?:,|$)", s2)
>>> res2
['Lead', 'Paints/Pigments', 'Zinc']

Regex for match parentheses in Python

I have a list of fasta sequences, each of which look like this:
>>> sequence_list[0]
'gi|13195623|ref|NM_024197.1| Mus musculus NADH dehydrogenase (ubiquinone) 1 alp
ha subcomplex 10 (Ndufa10), mRNAGCCGGCGCAGACGGCGAAGTCATGGCCTTGAGGTTGCTGAGACTCGTC
CCGGCGTCGGCTCCCGCGCGCGGCCTCGCGGCCGGAGCCCAGCGCGTGGG (etc)
I'd like to be able to extract the gene names from each of the fasta entries in my list, but I'm having difficulty finding the right regular expression. I thought this one would work: "^/(.+/),$". Start with a parentheses, then any number of any character, then end with a parentheses followed by a comma. Unfortunately: this returns None:
test = re.search(r"^/(.+/),$", sequence_list[0])
print(test)
Can someone point out the error in this regex?

Without any capturing groups,
>>> import re
>>> str = """
... gi|13195623|ref|NM_024197.1| Mus musculus NADH dehydrogenase (ubiquinone) 1 alp
... ha subcomplex 10 (Ndufa10), mRNAGCCGGCGCAGACGGCGAAGTCATGGCCTTGAGGTTGCTGAGACTCGTC
... CCGGCGTCGGCTCCCGCGCGCGGCCTCGCGGCCGGAGCCCAGCGCGTGGG (etc)"""
>>> m = re.findall(r'(?<=\().*?(?=\),)', str)
>>> m
['Ndufa10']
It matches only the words which are inside the parenthesis only when the closing bracket is followed by a comma.
DEMO
Explanation:
(?<=\() In regex (?<=pattern) is called a lookbehind. It actually looks after a string which matches the pattern inside lookbehind . In our case the pattern inside the lookbehind is \( means a literal (.
.*?(?=\),) It matches any character zero or more times. ? after the * makes the match reluctant. So it does an shortest match. And the characters in which the regex engine is going to match must be followed by ),

you need to escape parenthesis:
>>> re.findall(r'\([^)]*\),', txt)
['(Ndufa10),']

Can someone point out the error in this regex? r"^/(.+/),$"
regex escape character is \ not / (do not confuse with python escape character which is also \, but is not needed when using raw strings)
=> r"^\(.+\),$"
^ and $ match start/end of the input string, not what you want to output
=> r"\(.+\),"
you need to match "any" characters up to 1st occurence of ), not to the last one, so you need lazy operator +?
=> r"\(.+?\),"
in case gene names could not contain ) character, you can use a faster regex that avoids backtracking
=> r"\([^)]+\),"