I have multiple 3 GB tab delimited files. There are 20 million rows in each file. All the rows have to be independently processed, no relation between any two rows. My question is, what will be faster?
Reading line-by-line?
with open() as infile:
for line in infile:
Reading the file into memory in chunks and processing it, say 250 MB at a time?
The processing is not very complicated, I am just grabbing value in column1 to List1, column2 to List2 etc. Might need to add some column values together.
I am using python 2.7 on a linux box that has 30GB of memory. ASCII Text.
Any way to speed things up in parallel? Right now I am using the former method and the process is very slow. Is using any CSVReader module going to help?
I don't have to do it in python, any other language or database use ideas are welcome.
It sounds like your code is I/O bound. This means that multiprocessing isn't going to help—if you spend 90% of your time reading from disk, having an extra 7 processes waiting on the next read isn't going to help anything.
And, while using a CSV reading module (whether the stdlib's csv or something like NumPy or Pandas) may be a good idea for simplicity, it's unlikely to make much difference in performance.
Still, it's worth checking that you really are I/O bound, instead of just guessing. Run your program and see whether your CPU usage is close to 0% or close to 100% or a core. Do what Amadan suggested in a comment, and run your program with just pass for the processing and see whether that cuts off 5% of the time or 70%. You may even want to try comparing with a loop over os.open and os.read(1024*1024) or something and see if that's any faster.
Since your using Python 2.x, Python is relying on the C stdio library to guess how much to buffer at a time, so it might be worth forcing it to buffer more. The simplest way to do that is to use readlines(bufsize) for some large bufsize. (You can try different numbers and measure them to see where the peak is. In my experience, usually anything from 64K-8MB is about the same, but depending on your system that may be different—especially if you're, e.g., reading off a network filesystem with great throughput but horrible latency that swamps the throughput-vs.-latency of the actual physical drive and the caching the OS does.)
So, for example:
bufsize = 65536
with open(path) as infile:
while True:
lines = infile.readlines(bufsize)
if not lines:
break
for line in lines:
process(line)
Meanwhile, assuming you're on a 64-bit system, you may want to try using mmap instead of reading the file in the first place. This certainly isn't guaranteed to be better, but it may be better, depending on your system. For example:
with open(path) as infile:
m = mmap.mmap(infile, 0, access=mmap.ACCESS_READ)
A Python mmap is sort of a weird object—it acts like a str and like a file at the same time, so you can, e.g., manually iterate scanning for newlines, or you can call readline on it as if it were a file. Both of those will take more processing from Python than iterating the file as lines or doing batch readlines (because a loop that would be in C is now in pure Python… although maybe you can get around that with re, or with a simple Cython extension?)… but the I/O advantage of the OS knowing what you're doing with the mapping may swamp the CPU disadvantage.
Unfortunately, Python doesn't expose the madvise call that you'd use to tweak things in an attempt to optimize this in C (e.g., explicitly setting MADV_SEQUENTIAL instead of making the kernel guess, or forcing transparent huge pages)—but you can actually ctypes the function out of libc.
I know this question is old; but I wanted to do a similar thing, I created a simple framework which helps you read and process a large file in parallel. Leaving what I tried as an answer.
This is the code, I give an example in the end
def chunkify_file(fname, size=1024*1024*1000, skiplines=-1):
"""
function to divide a large text file into chunks each having size ~= size so that the chunks are line aligned
Params :
fname : path to the file to be chunked
size : size of each chink is ~> this
skiplines : number of lines in the begining to skip, -1 means don't skip any lines
Returns :
start and end position of chunks in Bytes
"""
chunks = []
fileEnd = os.path.getsize(fname)
with open(fname, "rb") as f:
if(skiplines > 0):
for i in range(skiplines):
f.readline()
chunkEnd = f.tell()
count = 0
while True:
chunkStart = chunkEnd
f.seek(f.tell() + size, os.SEEK_SET)
f.readline() # make this chunk line aligned
chunkEnd = f.tell()
chunks.append((chunkStart, chunkEnd - chunkStart, fname))
count+=1
if chunkEnd > fileEnd:
break
return chunks
def parallel_apply_line_by_line_chunk(chunk_data):
"""
function to apply a function to each line in a chunk
Params :
chunk_data : the data for this chunk
Returns :
list of the non-None results for this chunk
"""
chunk_start, chunk_size, file_path, func_apply = chunk_data[:4]
func_args = chunk_data[4:]
t1 = time.time()
chunk_res = []
with open(file_path, "rb") as f:
f.seek(chunk_start)
cont = f.read(chunk_size).decode(encoding='utf-8')
lines = cont.splitlines()
for i,line in enumerate(lines):
ret = func_apply(line, *func_args)
if(ret != None):
chunk_res.append(ret)
return chunk_res
def parallel_apply_line_by_line(input_file_path, chunk_size_factor, num_procs, skiplines, func_apply, func_args, fout=None):
"""
function to apply a supplied function line by line in parallel
Params :
input_file_path : path to input file
chunk_size_factor : size of 1 chunk in MB
num_procs : number of parallel processes to spawn, max used is num of available cores - 1
skiplines : number of top lines to skip while processing
func_apply : a function which expects a line and outputs None for lines we don't want processed
func_args : arguments to function func_apply
fout : do we want to output the processed lines to a file
Returns :
list of the non-None results obtained be processing each line
"""
num_parallel = min(num_procs, psutil.cpu_count()) - 1
jobs = chunkify_file(input_file_path, 1024 * 1024 * chunk_size_factor, skiplines)
jobs = [list(x) + [func_apply] + func_args for x in jobs]
print("Starting the parallel pool for {} jobs ".format(len(jobs)))
lines_counter = 0
pool = mp.Pool(num_parallel, maxtasksperchild=1000) # maxtaskperchild - if not supplied some weird happend and memory blows as the processes keep on lingering
outputs = []
for i in range(0, len(jobs), num_parallel):
print("Chunk start = ", i)
t1 = time.time()
chunk_outputs = pool.map(parallel_apply_line_by_line_chunk, jobs[i : i + num_parallel])
for i, subl in enumerate(chunk_outputs):
for x in subl:
if(fout != None):
print(x, file=fout)
else:
outputs.append(x)
lines_counter += 1
del(chunk_outputs)
gc.collect()
print("All Done in time ", time.time() - t1)
print("Total lines we have = {}".format(lines_counter))
pool.close()
pool.terminate()
return outputs
Say for example, I have a file in which I want to count the number of words in each line, then the processing of each line would look like
def count_words_line(line):
return len(line.strip().split())
and then call the function like:
parallel_apply_line_by_line(input_file_path, 100, 8, 0, count_words_line, [], fout=None)
Using this, I get a speed up of ~8 times as compared to vanilla line by line reading on a sample file of size ~20GB in which I do some moderately complicated processing on each line.
Related
I am trying to read a large text file > 20Gb with python.
File contains positions of atoms for 400 frames and each frame is independent in terms of my computations in this code. In theory I can split the job to 400 tasks without any need of communication. Each frame has 1000000 lines so the file has 1000 000* 400 lines of text.
My initial approach is using multiprocessing with pool of workers:
def main():
""" main function
"""
filename=sys.argv[1]
nump = int(sys.argv[2])
f = open(filename)
s = mmap.mmap(f.fileno(), 0, access=mmap.ACCESS_READ)
cursor = 0
framelocs=[]
start = time.time()
print (mp.cpu_count())
chunks = []
while True:
initial = s.find(b'ITEM: TIMESTEP', cursor)
if initial == -1:
break
cursor = initial + 14
final = s.find(b'ITEM: TIMESTEP', cursor)
framelocs.append([initial,final])
#readchunk(s[initial:final])
chunks.append(s[initial:final])
if final == -1:
break
Here basically I am seeking file to find frame begins and ends with opening file with python mmap module to avoid reading everything into memory.
def readchunk(chunk):
start = time.time()
part = chunk.split(b'\n')
timestep= int(part[1])
print(timestep)
Now I would like to send chunks of file to pool of workers to process.
Read part should be more complex but those lines will be implemented later.
print('Seeking file took %8.6f'%(time.time()-start))
pool = mp.Pool(nump)
start = time.time()
results= pool.map(readchunk,chunks[0:16])
print('Reading file took %8.6f'%(time.time()-start))
If I run this with sending 8 chunks to 8 cores it would take 0.8 sc to read.
However
If I run this with sending 16 chunks to 16 cores it would take 1.7 sc. Seems like parallelization does not speed up. I am running this on Oak Ridge's Summit supercomputer if it is relevant, I am using this command:
jsrun -n1 -c16 -a1 python -u ~/Developer/DipoleAnalyzer/AtomMan/readlargefile.py DW_SET6_NVT.lammpstrj 16
This supposed to create 1 MPI task and assign 16 cores to 16 threads.
Am I missing here something?
Is there a better approach?
As others have said, there is some overhead when making processes so you could see a slowdown if testing with small samples.
Something like this might be neater. Make sure you understand what the generator function is doing.
import multiprocessing as mp
import sys
import mmap
def do_something_with_frame(frame):
print("processing a frame:")
return 100
def frame_supplier(filename):
"""A generator for frames"""
f = open(filename)
s = mmap.mmap(f.fileno(), 0, access=mmap.ACCESS_READ)
cursor = 0
while True:
initial = s.find(b'ITEM: TIMESTEP', cursor)
if initial == -1:
break
cursor = initial + 14
final = s.find(b'ITEM: TIMESTEP', cursor)
yield s[initial:final]
if final == -1:
break
def main():
"""Process a file of atom frames
Args:
filename: the file to process
processes: the size of the pool
"""
filename = sys.argv[1]
nump = int(sys.argv[2])
frames = frame_supplier(filename)
pool = mp.Pool(nump)
# play around with the chunksize
for result in pool.imap(do_something_with_frame, frames, chunksize=10):
print(result)
Disclaimer: this is a suggestion. There may be some syntax errors. I haven't tested it.
EDIT:
It sounds like your script is becoming I/O limited (i.e. limited by the rate at which you can read from disk). You should be able to verify this by setting the body of do_something_with_frame to pass. If the program is I/O bound, it will still take nearly as long.
I don't think MPI is going to make any difference here. I think that file-read speed is probably a limiting factor and I don't see how MPI will help.
It's worth doing some profiling at this point to find out which function calls are taking the longest.
It is also worth trying without mmap():
frame = []
with open(filename) as file:
for line in file:
if line.beginswith('ITEM: TIMESTEP'):
yield frame
else:
frame.append(line)
I posted a similar question a few days ago but without any code, now I created a test code in hopes of getting some help.
Code is at the bottom.
I got some dataset where I have a bunch of large files (~100) and I want to extract specific lines from those files very efficiently (both in memory and in speed).
My code gets a list of relevant files, the code opens each file with [line 1], then maps the file to memory with [line 2], also, for each file I receives a list of indices and going over the indices I retrieve the relevant information (10 bytes for this example) like so: [line 3-4], finally I close the handles with [line 5-6].
binaryFile = open(path, "r+b")
binaryFile_mm = mmap.mmap(binaryFile.fileno(), 0)
for INDEX in INDEXES:
information = binaryFile_mm[(INDEX):(INDEX)+10].decode("utf-8")
binaryFile_mm.close()
binaryFile.close()
This codes runs in parallel, with thousands of indices for each file, and continuously do that several times a second for hours.
Now to the problem - The code runs well when I limit the indices to be small (meaning - when I ask the code to get information from the beginning of the file). But! when I increase the range of the indices, everything slows down to (almost) a halt AND the buff/cache memory gets full (I'm not sure if the memory issue is related to the slowdown).
So my question is why does it matter if I retrieve information from the beginning or the end of the file and how do I overcome this in order to get instant access to information from the end of the file without slowing down and increasing buff/cache memory use.
PS - some numbers and sizes: so I got ~100 files each about 1GB in size, when I limit the indices to be from the 0%-10% of the file it runs fine, but when I allow the index to be anywhere in the file it stops working.
Code - tested on linux and windows with python 3.5, requires 10 GB of storage (creates 3 files with random strings inside 3GB each)
import os, errno, sys
import random, time
import mmap
def create_binary_test_file():
print("Creating files with 3,000,000,000 characters, takes a few seconds...")
test_binary_file1 = open("test_binary_file1.testbin", "wb")
test_binary_file2 = open("test_binary_file2.testbin", "wb")
test_binary_file3 = open("test_binary_file3.testbin", "wb")
for i in range(1000):
if i % 100 == 0 :
print("progress - ", i/10, " % ")
# efficiently create random strings and write to files
tbl = bytes.maketrans(bytearray(range(256)),
bytearray([ord(b'a') + b % 26 for b in range(256)]))
random_string = (os.urandom(3000000).translate(tbl))
test_binary_file1.write(str(random_string).encode('utf-8'))
test_binary_file2.write(str(random_string).encode('utf-8'))
test_binary_file3.write(str(random_string).encode('utf-8'))
test_binary_file1.close()
test_binary_file2.close()
test_binary_file3.close()
print("Created binary file for testing.The file contains 3,000,000,000 characters")
# Opening binary test file
try:
binary_file = open("test_binary_file1.testbin", "r+b")
except OSError as e: # this would be "except OSError, e:" before Python 2.6
if e.errno == errno.ENOENT: # errno.ENOENT = no such file or directory
create_binary_test_file()
binary_file = open("test_binary_file1.testbin", "r+b")
## example of use - perform 100 times, in each itteration: open one of the binary files and retrieve 5,000 sample strings
## (if code runs fast and without a slowdown - increase the k or other numbers and it should reproduce the problem)
## Example 1 - getting information from start of file
print("Getting information from start of file")
etime = []
for i in range(100):
start = time.time()
binary_file_mm = mmap.mmap(binary_file.fileno(), 0)
sample_index_list = random.sample(range(1,100000-1000), k=50000)
sampled_data = [[binary_file_mm[v:v+1000].decode("utf-8")] for v in sample_index_list]
binary_file_mm.close()
binary_file.close()
file_number = random.randint(1, 3)
binary_file = open("test_binary_file" + str(file_number) + ".testbin", "r+b")
etime.append((time.time() - start))
if i % 10 == 9 :
print("Iter ", i, " \tAverage time - ", '%.5f' % (sum(etime[-9:]) / len(etime[-9:])))
binary_file.close()
## Example 2 - getting information from all of the file
print("Getting information from all of the file")
binary_file = open("test_binary_file1.testbin", "r+b")
etime = []
for i in range(100):
start = time.time()
binary_file_mm = mmap.mmap(binary_file.fileno(), 0)
sample_index_list = random.sample(range(1,3000000000-1000), k=50000)
sampled_data = [[binary_file_mm[v:v+1000].decode("utf-8")] for v in sample_index_list]
binary_file_mm.close()
binary_file.close()
file_number = random.randint(1, 3)
binary_file = open("test_binary_file" + str(file_number) + ".testbin", "r+b")
etime.append((time.time() - start))
if i % 10 == 9 :
print("Iter ", i, " \tAverage time - ", '%.5f' % (sum(etime[-9:]) / len(etime[-9:])))
binary_file.close()
My results: (The average time of getting information from all across the file is almost 4 times slower than getting information from the beginning, with ~100 files and parallel computing this difference gets much bigger)
Getting information from start of file
Iter 9 Average time - 0.14790
Iter 19 Average time - 0.14590
Iter 29 Average time - 0.14456
Iter 39 Average time - 0.14279
Iter 49 Average time - 0.14256
Iter 59 Average time - 0.14312
Iter 69 Average time - 0.14145
Iter 79 Average time - 0.13867
Iter 89 Average time - 0.14079
Iter 99 Average time - 0.13979
Getting information from all of the file
Iter 9 Average time - 0.46114
Iter 19 Average time - 0.47547
Iter 29 Average time - 0.47936
Iter 39 Average time - 0.47469
Iter 49 Average time - 0.47158
Iter 59 Average time - 0.47114
Iter 69 Average time - 0.47247
Iter 79 Average time - 0.47881
Iter 89 Average time - 0.47792
Iter 99 Average time - 0.47681
The basic reason why you have this time difference is that you have to seek to where you need in the file. The further from position 0 you are, the longer it's going to take.
What might help is since you know the starting index you need, seek on the file descriptor to that point and then do the mmap. Or really, why bother with mmap in the first place - just read the number of bytes that you need from the seeked-to position, and put that into your result variable.
To determine if you're getting adequate performance, check the memory available for the buffer/page cache (free in Linux), I/O stats - the number of reads, their size and duration (iostat; compare with the specs of your hardware), and the CPU utilization of your process.
[edit] Assuming that you read from a locally attached SSD (without having the data you need in the cache):
When reading in a single thread, you should expect your batch of 50,000 reads to take more than 7 seconds (50000*0.000150). Probably longer because the 50k accesses of a mmap-ed file will trigger more or larger reads, as your accesses are not page-aligned - as I suggested in another Q&A I'd use simple seek/read instead (and open the file with buffering=0 to avoid unnecessary reads for Python buffered I/O).
With more threads/processes reading simultaneously, you can saturate your SSD throughput (how much 4KB reads/s it can do - it can be anywhere from 5,000 to 1,000,000), then the individual reads will become even slower.
[/edit]
The first example only accesses 3*100KB of the files' data, so as you have much more than that available for the cache, all of the 300KB quickly end up in the cache, so you'll see no I/O, and your python process will be CPU-bound.
I'm 99.99% sure that if you test reading from the last 100KB of each file, it will perform as well as the first example - it's not about the location of the data, but about the size of the data accessed.
The second example accesses random portions from 9GB, so you can hope to see similar performance only if you have enough free RAM to cache all of the 9GB, and only after you preload the files into the cache, so that the testcase runs with zero I/O.
In realistic scenarios, the files will not be fully in the cache - so you'll see many I/O requests and much lower CPU utilization for python. As I/O is much slower than cached access, you should expect this example to run slower.
I have CSV files with up to 10M+ rows. I am attempting to get the total line numbers of a file so I can split the processing of each file into a multiprocessing approach. To do this, I will set a start and end line for each sub-process to handle. This cuts down my processing time from 180s to 110s for a file size of 2GB. However, in order to do this, It requires to know the line number count. If I attempt to get the exact line number count, it will take ~30seconds. I feel like this time is wasted as an approximate with the final thread possibly having to read an extra hundred thousand lines or so, would only add a couple seconds as apposed to the 30 seconds it takes to get the exact line count.
How would I go about getting an approximate line count for files? I would like this estimate to be within 1 million lines (Preferably within a couple hundred thousand lines). Would something like this be possible?
This will be horribly inaccurate but it will get the size of a row and divide it against the size of the file.
import sys
import csv
import os
with open("example.csv", newline="") as f:
reader = csv.reader(f)
row1 = next(reader)
_Size = sys.getsizeof(len("".join(row1)))
print("Size of Line 1 > ",_Size)
print("Size of File >",str(os.path.getsize("example.csv")))
print("Approx Lines >",(os.path.getsize("example.csv") / _Size))
(Edit) If you change the last line to
math.floor(os.path.getsize("example.csv") / _Size) It's actually
quite accurate
I'd suggest you split the file into chunks of similar size, before even parsing.
The example code below will split data.csv into 4 chunks of approximately equal size, by seeking and searching for the next line break. It'll then call launch_worker() for each chunk, indicating the start offset and length of the data that worker should handle.
Ideally you'd use a subprocess for each worker.
import os
n_workers = 4
# open the log file, and find out how long it is
f = open('data.csv', 'rb')
length_total = f.seek(0, os.SEEK_END)
# split the file evenly among n workers
length_worker = int(length_total / n_workers)
prev_worker_end = 0
for i in range(n_workers):
# seek to the next worker's approximate start
file_pos = f.seek(prev_worker_end + length_worker, os.SEEK_SET)
# see if we tried to seek past the end of the file... the last worker probably will
if file_pos >= length_total: # <-- (3)
# ... if so, this worker's chunk extends to the end of the file
this_worker_end = length_total
else:
# ... otherwise, look for the next line break
buf = f.read(256) # <-- (1)
next_line_end = buf.index(b'\n') # <-- (2)
this_worker_end = file_pos + next_line_end
# calculate how long this worker's chunk is
this_worker_length = this_worker_end - prev_worker_end
if this_worker_length > 0:
# if there is any data in the chunk, then try to launch a worker
launch_worker(prev_worker_end, this_worker_length)
# remember where the last worker got to in the file
prev_worker_end = this_worker_end + 1
Some expansion on markers in the code:
You'll need to make sure that the read() will consume at least an entire line. Alternatively you could loop to perform multiple read()s if you don't know how long a line could be upfront.
This assumes \n line endings... you may need to modify for your data.
The last worker will get slightly less data to handle that the others... this is because we always search-forwards for the next line break. The more workers you have, the less data the final worker gets. It's not very significant (~200-500 bytes in my testing).
Make sure you always use binary-mode, as text-mode can give you wonky seek()s / read()s.
An example launch_worker() would look like this:
def launch_worker(offset, length):
print('Starting a worker... using chunk %d - %d (%d bytes)...'
% ( offset, offset + length, length ))
with open('log.txt', 'rb') as f:
f.seek(offset, os.SEEK_SET)
worker_buf = f.read(length)
lines = worker_buf.split(b'\n')
print('First Line:')
print('\t' + str(lines[0]))
print('Last Line:')
print('\t' + str(lines[-1]))
Samples records in the data file (SAM file):
M01383 0 chr4 66439384 255 31M * 0 0 AAGAGGA GFAFHGD MD:Z:31 NM:i:0
M01382 0 chr1 241995435 255 31M * 0 0 ATCCAAG AFHTTAG MD:Z:31 NM:i:0
......
The data files are line-by-line based
The size of the data files are varies from 1G - 5G.
I need to go through the record in the data file line by line, get a particular value (e.g. 4th value, 66439384) from each line, and pass this value to another function for processing. Then some results counter will be updated.
the basic workflow is like this:
# global variable, counters will be updated in search function according to the value passed.
counter_a = 0
counter_b = 0
counter_c = 0
open textfile:
for line in textfile:
value = line.split()[3]
search_function(value) # this function takes abit long time to process
def search_function (value):
some conditions checking:
update the counter_a or counter_b or counter_c
With single process code and about 1.5G data file, it took about 20 hours to run through all the records in one data file. I need much faster code because there are more than 30 of this kind data file.
I was thinking to process the data file in N chunks in parallel, and each chunk will perform above workflow and update the global variable (counter_a, counter_b, counter_c) simultaneously. But I don't know how to achieve this in code, or wether this will work.
I have access to a server machine with: 24 processors and around 40G RAM.
Anyone could help with this? Thanks very much.
The simplest approach would probably be to do all 30 files at once with your existing code -- would still take all day, but you'd have all the files done at once. (ie, "9 babies in 9 months" is easy, "1 baby in 1 month" is hard)
If you really want to get a single file done faster, it will depend on how your counters actually update. If almost all the work is just in analysing value you can offload that using the multiprocessing module:
import time
import multiprocessing
def slowfunc(value):
time.sleep(0.01)
return value**2 + 0.3*value + 1
counter_a = counter_b = counter_c = 0
def add_to_counter(res):
global counter_a, counter_b, counter_c
counter_a += res
counter_b -= (res - 10)**2
counter_c += (int(res) % 2)
pool = multiprocessing.Pool(50)
results = []
for value in range(100000):
r = pool.apply_async(slowfunc, [value])
results.append(r)
# don't let the queue grow too long
if len(results) == 1000:
results[0].wait()
while results and results[0].ready():
r = results.pop(0)
add_to_counter(r.get())
for r in results:
r.wait()
add_to_counter(r.get())
print counter_a, counter_b, counter_c
That will allow 50 slowfuncs to run in parallel, so instead of taking 1000s (=100k*0.01s), it takes 20s (100k/50)*0.01s to complete. If you can restructure your function into "slowfunc" and "add_to_counter" like the above, you should be able to get a factor of 24 speedup.
Read one file at a time, use all CPUs to run search_function():
#!/usr/bin/env python
from multiprocessing import Array, Pool
def init(counters_): # called for each child process
global counters
counters = counters_
def search_function (value): # assume it is CPU-intensive task
some conditions checking:
update the counter_a or counter_b or counter_c
counter[0] += 1 # counter 'a'
counter[1] += 1 # counter 'b'
return value, result, error
if __name__ == '__main__':
counters = Array('i', [0]*3)
pool = Pool(initializer=init, initargs=[counters])
values = (line.split()[3] for line in textfile)
for value, result, error in pool.imap_unordered(search_function, values,
chunksize=1000):
if error is not None:
print('value: {value}, error: {error}'.format(**vars()))
pool.close()
pool.join()
print(list(counters))
Make sure (for example, by writing wrappers) that exceptions do not escape next(values), search_function().
This solution works on a set of files.
For each file, it divides it into a specified number of line-aligned chunks, solves each chunk in parallel, then combines the results.
It streams each chunk from disk; this is somewhat slower, but does not consume nearly so much memory. We depend on disk cache and buffered reads to prevent head thrashing.
Usage is like
python script.py -n 16 sam1.txt sam2.txt sam3.txt
and script.py is
import argparse
from io import SEEK_END
import multiprocessing as mp
#
# Worker process
#
def summarize(fname, start, stop):
"""
Process file[start:stop]
start and stop both point to first char of a line (or EOF)
"""
a = 0
b = 0
c = 0
with open(fname, newline='') as inf:
# jump to start position
pos = start
inf.seek(pos)
for line in inf:
value = int(line.split(4)[3])
# *** START EDIT HERE ***
#
# update a, b, c based on value
#
# *** END EDIT HERE ***
pos += len(line)
if pos >= stop:
break
return a, b, c
def main(num_workers, sam_files):
print("{} workers".format(num_workers))
pool = mp.Pool(processes=num_workers)
# for each input file
for fname in sam_files:
print("Dividing {}".format(fname))
# decide how to divide up the file
with open(fname) as inf:
# get file length
inf.seek(0, SEEK_END)
f_len = inf.tell()
# find break-points
starts = [0]
for n in range(1, num_workers):
# jump to approximate break-point
inf.seek(n * f_len // num_workers)
# find start of next full line
inf.readline()
# store offset
starts.append(inf.tell())
# do it!
stops = starts[1:] + [f_len]
start_stops = zip(starts, stops)
print("Solving {}".format(fname))
results = [pool.apply(summarize, args=(fname, start, stop)) for start,stop in start_stops]
# collect results
results = [sum(col) for col in zip(*results)]
print(results)
if __name__ == "__main__":
parser = argparse.ArgumentParser(description='Parallel text processor')
parser.add_argument('--num_workers', '-n', default=8, type=int)
parser.add_argument('sam_files', nargs='+')
args = parser.parse_args()
main(args.num_workers, args.sam_files)
main(args.num_workers, args.sam_files)
What you don't want to do is hand files to invidual CPUs. If that's the case, the file open/reads will likely cause the heads to bounce randomly all over the disk, because the files are likely to be all over the disk.
Instead, break each file into chunks and process the chunks.
Open the file with one CPU. Read in the whole thing into an array Text. You want to do this is one massive read to prevent the heads from thrashing around the disk, under the assumption that your file(s) are placed on the disk in relatively large sequential chunks.
Divide its size in bytes by N, giving a (global) value K, the approximate number of bytes each CPU should process. Fork N threads, and hand each thread i its index i, and a copied handle for each file.
Each thread i starts a thread-local scan pointer p into Text as offset i*K. It scans the text, incrementing p and ignores the text until a newline is found. At this point, it starts processing lines (increment p as it scans the lines). Tt stops after processing a line, when its index into the Text file is greater than (i+1)*K.
If the amount of work per line is about equal, your N cores will all finish about the same time.
(If you have more than one file, you can then start the next one).
If you know that the file sizes are smaller than memory, you might arrange the file reads to be pipelined, e.g., while the current file is being processed, a file-read thread is reading the next file.
The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it:
What is the fastest (least execution
time) way to split a text file in to
ALL (overlapping) substrings of size N (bound N, eg 36)
while throwing out newline characters.
I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like.
As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module.
Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do.
My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8
>>>import cStringIO
>>>example_file = cStringIO.StringIO("""\
>header
CAGTcag
TFgcACF
""")
>>>for read in parse(example_file):
... print read
...
CAGTCAGTF
AGTCAGTFG
GTCAGTFGC
TCAGTFGCA
CAGTFGCAC
AGTFGCACF
The function that I found had the absolute best performance from the methods I could think of is this:
def parse(file):
size = 8 # of course in my code this is a function argument
file.readline() # skip past the header
buffer = ''
for line in file:
buffer += line.rstrip().upper()
while len(buffer) >= size:
yield buffer[:size]
buffer = buffer[1:]
This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community.
Thanks!
Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size.
Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!
Could you mmap the file and start pecking through it with a sliding window? I wrote a stupid little program that runs pretty small:
USER PID %CPU %MEM VSZ RSS TTY STAT START TIME COMMAND
sarnold 20919 0.0 0.0 33036 4960 pts/2 R+ 22:23 0:00 /usr/bin/python ./sliding_window.py
Working through a 636229 byte fasta file (found via http://biostar.stackexchange.com/questions/1759) took .383 seconds.
#!/usr/bin/python
import mmap
import os
def parse(string, size):
stride = 8
start = string.find("\n")
while start < size - stride:
print string[start:start+stride]
start += 1
fasta = open("small.fasta", 'r')
fasta_size = os.stat("small.fasta").st_size
fasta_map = mmap.mmap(fasta.fileno(), 0, mmap.MAP_PRIVATE, mmap.PROT_READ)
parse(fasta_map, fasta_size)
Some classic IO bound changes.
Use a lower level read operation like os.read and read in to a large fixed buffer.
Use threading/multiprocessing where one reads and buffers and the other processes.
If you have multiple processors/machines use multiprocessing/mq to divy up processing across CPUs ala map-reduce.
Using a lower level read operation wouldn't be that much of a rewrite. The others would be pretty large rewrites.
I suspect the problem is that you have so much data stored in string format, which is really wasteful for your use case, that you're running out of real memory and thrashing swap. 128 GB should be enough to avoid this... :)
Since you've indicated in comments that you need to store additional information anyway, a separate class which references a parent string would be my choice. I ran a short test using chr21.fa from chromFa.zip from hg18; the file is about 48MB and just under 1M lines. I only have 1GB of memory here, so I simply discard the objects afterwards. This test thus won't show problems with fragmentation, cache, or related, but I think it should be a good starting point for measuring parsing throughput:
import mmap
import os
import time
import sys
class Subseq(object):
__slots__ = ("parent", "offset", "length")
def __init__(self, parent, offset, length):
self.parent = parent
self.offset = offset
self.length = length
# these are discussed in comments:
def __str__(self):
return self.parent[self.offset:self.offset + self.length]
def __hash__(self):
return hash(str(self))
def __getitem__(self, index):
# doesn't currently handle slicing
assert 0 <= index < self.length
return self.parent[self.offset + index]
# other methods
def parse(file, size=8):
file.readline() # skip header
whole = "".join(line.rstrip().upper() for line in file)
for offset in xrange(0, len(whole) - size + 1):
yield Subseq(whole, offset, size)
class Seq(object):
__slots__ = ("value", "offset")
def __init__(self, value, offset):
self.value = value
self.offset = offset
def parse_sep_str(file, size=8):
file.readline() # skip header
whole = "".join(line.rstrip().upper() for line in file)
for offset in xrange(0, len(whole) - size + 1):
yield Seq(whole[offset:offset + size], offset)
def parse_plain_str(file, size=8):
file.readline() # skip header
whole = "".join(line.rstrip().upper() for line in file)
for offset in xrange(0, len(whole) - size + 1):
yield whole[offset:offset+size]
def parse_tuple(file, size=8):
file.readline() # skip header
whole = "".join(line.rstrip().upper() for line in file)
for offset in xrange(0, len(whole) - size + 1):
yield (whole, offset, size)
def parse_orig(file, size=8):
file.readline() # skip header
buffer = ''
for line in file:
buffer += line.rstrip().upper()
while len(buffer) >= size:
yield buffer[:size]
buffer = buffer[1:]
def parse_os_read(file, size=8):
file.readline() # skip header
file_size = os.fstat(file.fileno()).st_size
whole = os.read(file.fileno(), file_size).replace("\n", "").upper()
for offset in xrange(0, len(whole) - size + 1):
yield whole[offset:offset+size]
def parse_mmap(file, size=8):
file.readline() # skip past the header
buffer = ""
for line in file:
buffer += line
if len(buffer) >= size:
for start in xrange(0, len(buffer) - size + 1):
yield buffer[start:start + size].upper()
buffer = buffer[-(len(buffer) - size + 1):]
for start in xrange(0, len(buffer) - size + 1):
yield buffer[start:start + size]
def length(x):
return sum(1 for _ in x)
def duration(secs):
return "%dm %ds" % divmod(secs, 60)
def main(argv):
tests = [parse, parse_sep_str, parse_tuple, parse_plain_str, parse_orig, parse_os_read]
n = 0
for fn in tests:
n += 1
with open(argv[1]) as f:
start = time.time()
length(fn(f))
end = time.time()
print "%d %-20s %s" % (n, fn.__name__, duration(end - start))
fn = parse_mmap
n += 1
with open(argv[1]) as f:
f = mmap.mmap(f.fileno(), 0, mmap.MAP_PRIVATE, mmap.PROT_READ)
start = time.time()
length(fn(f))
end = time.time()
print "%d %-20s %s" % (n, fn.__name__, duration(end - start))
if __name__ == "__main__":
sys.exit(main(sys.argv))
1 parse 1m 42s
2 parse_sep_str 1m 42s
3 parse_tuple 0m 29s
4 parse_plain_str 0m 36s
5 parse_orig 0m 45s
6 parse_os_read 0m 34s
7 parse_mmap 0m 37s
The first four are my code, while orig is yours and the last two are from other answers here.
User-defined objects are much more costly to create and collect than tuples or plain strings! This shouldn't be that surprising, but I had not realized it would make this much of a difference (compare #1 and #3, which really only differ in a user-defined class vs tuple). You said you want to store additional information, like offset, with the string anyway (as in the parse and parse_sep_str cases), so you might consider implementing that type in a C extension module. Look at Cython and related if you don't want to write C directly.
Case #1 and #2 being identical is expected: by pointing to a parent string, I was trying to save memory rather than processing time, but this test doesn't measure that.
I have a function for process a text file and use buffer in read and write and parallel computing with async pool of workets of process. I have a AMD of 2 cores, 8GB RAM, with gnu/linux and can process 300000 lines in less of 1 second, 1000000 lines in aproximately 4 seconds and aproximately 4500000 lines (more of 220MB) in aproximately 20 seconds:
# -*- coding: utf-8 -*-
import sys
from multiprocessing import Pool
def process_file(f, fo="result.txt", fi=sys.argv[1]):
fi = open(fi, "r", 4096)
fo = open(fo, "w", 4096)
b = []
x = 0
result = None
pool = None
for line in fi:
b.append(line)
x += 1
if (x % 200000) == 0:
if pool == None:
pool = Pool(processes=20)
if result == None:
result = pool.map_async(f, b)
else:
presult = result.get()
result = pool.map_async(f, b)
for l in presult:
fo.write(l)
b = []
if not result == None:
for l in result.get():
fo.write(l)
if not b == []:
for l in b:
fo.write(f(l))
fo.close()
fi.close()
First argument is function that rceive one line, process and return result for will write in file, next is file of output and last is file of input (you can not use last argument if you receive as first parameter in your script file of input).