Code doesn't print the last sequence in a file - python

I have a file that looks like this:
<s0> 3
line1
line2
line3
<s1> 5
line1
line2
<s2> 4
etc. up to more than a thousand
Each sequence has a header like <s0> 3, which in this case states that three lines follow. In the example above, the number of lines below <s1> is two, so I have to correct the header to <s1> 2.
The code I have below picks out the sequence headers and the correct number of lines below them. But for some reason, it never gets the details of the last sequence. I know something is wrong but I don't know what. Can someone point me to what I am doing wrong?
import re
def call():
with open('trial_perl.txt') as fp:
docHeader = open("C:\path\header.txt","w")
c = 0
c1 = 0
header = []
k = -1
for line in fp:
if line.startswith("<s"):
#header = line.split(" ")
#print header[1]
c = 0
else:
c1 = c + 1
c += 1
if c == 0 and c1>0:
k +=1
printing = c1
if printing >= 0:
s = "<s%s>" % (k)
#print "%s %d" % (s, printing)
docHeader.write(s+" "+str(printing)+"\n")
call()

you have no sentinel at the end of the last sequence in your data, so your code will need to deal with the last sequence AFTER the loop is done.

If I may suggest some python tricks to get to your results; you don't need those c/c1/k counter variables, as they make the code more difficult to read and maintain. Instead, populate a map of sequence header to sequence items and then use the map to do all your work:
(this code works only if all sequence headers are unique - if you have duplicates, it won't work)
with open('trial_perl.txt') as fp:
docHeader = open("C:\path\header.txt","w")
data = {}
for line in fp:
if line.startswith("<s"):
current_sequence = line
# create a list with the header as the key
data[current_sequence] = []
else:
# add each sequence to the list we defined above
data[current_sequence].append(line)
Your map is ready! It looks like this:
{"<s0> 3": ["line1", "line2", "line5"],
"<s1> 5": ["line1", "line2"]}
You can iterate it like this:
for header, lines in data.items():
# header is the key, or "<s0> 3"
# lines is the list of lines under that header ["line1", "line2", etc]
num_of_lines = len(lines)

The main problem is that you neglect to check the value of c after you have read the last line. You probably had difficulty spotting this problem because of all the superfluous code. You don't have to increment k, since you can extract the value from the <s...> tag. And you don't have to have all three variables c, c1, and printing. A single count variable will do.
import re, sys
def call():
with open('trial_perl.txt') as fp:
docHeader = sys.stdout #open("C:\path\header.txt","w")
count = 0
id = None
for line in fp:
if line.startswith("<s"):
if id != None:
tag = '<s%s>' % id
docHeader.write('<s%d> %d\n' % (id, count))
count = 0
id = int(line[2:line.find('>')])
else:
count += 1
if id != None:
tag = '<s%s>' % id
docHeader.write('<s%d> %d\n' % (id, count))
call()

Another approach using groupby from itertools, where you take the maximum number of line in each group - a group corresponding to a sequence of header + line in your file: :
from itertools import groupby
def call():
with open('stack.txt') as fp:
header = [-1]
lines = [0]
for line in fp:
if line.startswith("<s"):
header.append(header[-1]+1)
lines.append(0)
else:
header.append(header[-1])
lines.append(lines[-1] +1)
with open('result','w') as f:
for key, group in groupby(zip(header[1:],lines[1:]), lambda x: x[0]):
f.write(str(("<s%d> %d\n" % max(group))))
f.close()
call()
#<s0> 3
#<s1> 2
stack.txt is the file containing your data:
<s0> 3
line1
line2
line3
<s1> 5
line1
line2

Related

Selecting line from file by using "startswith" and "next" commands

I have a file from which I want to create a list ("timestep") from the numbers which appear after each line "ITEM: TIMESTEP" so:
timestep = [253400, 253500, .. etc]
Here is the sample of the file I have:
ITEM: TIMESTEP
253400
ITEM: NUMBER OF ATOMS
378
ITEM: BOX BOUNDS pp pp pp
-2.6943709180241954e-01 5.6240920636804063e+01
-2.8194230631882372e-01 5.8851195163321044e+01
-2.7398090193568775e-01 5.7189372326936599e+01
ITEM: ATOMS id type q x y z
16865 3 0 28.8028 1.81293 26.876
16866 2 0 27.6753 2.22199 27.8362
16867 2 0 26.8715 1.04115 28.4178
16868 2 0 25.7503 1.42602 29.4002
16869 2 0 24.8716 0.25569 29.8897
16870 3 0 23.7129 0.593415 30.8357
16871 3 0 11.9253 -0.270359 31.7252
ITEM: TIMESTEP
253500
ITEM: NUMBER OF ATOMS
378
ITEM: BOX BOUNDS pp pp pp
-2.6943709180241954e-01 5.6240920636804063e+01
-2.8194230631882372e-01 5.8851195163321044e+01
-2.7398090193568775e-01 5.7189372326936599e+01
ITEM: ATOMS id type q x y z
16865 3 0 28.8028 1.81293 26.876
16866 2 0 27.6753 2.22199 27.8362
16867 2 0 26.8715 1.04115 28.4178
16868 2 0 25.7503 1.42602 29.4002
16869 2 0 24.8716 0.25569 29.8897
16870 3 0 23.7129 0.593415 30.8357
16871 3 0 11.9253 -0.270359 31.7252
To do this I tried to use "startswith" and "next" commands at once and it didn't work. Is there other way to do it? I send also the code I'm trying to use for that:
timestep = []
with open(file, 'r') as f:
lines = f.readlines()
for line in lines:
line = line.split()
if line[0].startswith("ITEM: TIMESTEP"):
timestep.append(next(line))
print(timestep)
The logic is to decide whether to append the current line to timestep or not. So, what you need is a variable which tells you append the current line when that variable is TRUE.
timestep = []
append_to_list = False # decision variable
with open(file, 'r') as f:
lines = f.readlines()
for line in lines:
line = line.strip() # remove "\n" from line
if line.startswith("ITEM"):
# Update add_to_list
if line == 'ITEM: TIMESTEP':
append_to_list = True
else:
append_to_list = False
else:
# append to list if line doesn't start with "ITEM" and append_to_list is TRUE
if append_to_list:
timestep.append(line)
print(timestep)
output:
['253400', '253500']
First - I don't like this, because it doesn't scale. You can only get the first immediately following line nicely, anything else will be just ugh...
But you asked, so ... for x in lines will create an iterator over lines and use that to keep the position. You don't have access to that iterator, so next will not be the next element you're expecting. But you can make your own iterator and use that:
lines_iter = iter(lines)
for line in lines_iter:
# whatever was here
timestep.append(next(line_iter))
However, if you ever want to scale it... for is not a good way to iterate over a file like this. You want to know what is in the next/previous line. I would suggest using while:
timestep = []
with open('example.txt', 'r') as f:
lines = f.readlines()
i = 0
while i < len(lines):
if line[i].startswith("ITEM: TIMESTEP"):
i += 1
while not line[i].startswith("ITEM: "):
timestep.append(next(line))
i += 1
else:
i += 1
This way you can extend it for different types of ITEMS of variable length.
So the problem with your code is subtle. You have a list lines which you iterate over, but you can't call next on a list.
Instead, turn it into an explicit iterator and you should be fine
timestep = []
with open(file, 'r') as f:
lines = f.readlines()
lines_iter = iter(lines)
for line in lines_iter:
line = line.strip() # removes the newline
if line.startswith("ITEM: TIMESTEP"):
timestep.append(next(lines_iter, None)) # the second argument here prevents errors
# when ITEM: TIMESTEP appears as the
# last line in the file
print(timestep)
I'm also not sure why you included line.split, which seems to be incorrect (in any case line.split()[0].startswith('ITEM: TIMESTEP') can never be true, since the split will separate ITEM: and TIMESTEP into separate elements of the resulting list.)
For a more robust answer, consider grouping your data based on when the line begins with ITEM.
def process_file(f):
ITEM_MARKER = 'ITEM: '
item_title = '(none)'
values = []
for line in f:
if line.startswith(ITEM_MARKER):
if values:
yield (item_title, values)
item_title = line[len(ITEM_MARKER):].strip() # strip off the marker
values = []
else:
values.append(line.strip())
if values:
yield (item_title, values)
This will let you pass in the whole file and will lazily produce a set of values for each ITEM: <whatever> group. Then you can aggregate in some reasonable way.
with open(file, 'r') as f:
groups = process_file(f)
aggregations = {}
for name, values in groups:
aggregations.setdefault(name, []).extend(values)
print(aggregations['TIMESTEP']) # this is what you want
You can use enumerate to help with index referencing. We can check to see if the string ITEM: TIMESTEP is in the previous line then add the integer to our timestep list.
timestep = []
with open('example.txt', 'r') as f:
lines = f.readlines()
for i, line in enumerate(lines):
if "ITEM: TIMESTEP" in lines[i-1]:
timestep.append(int(line.strip()))
print(timestep)

Python; print filename and header

I have files (fasta files with a sequence) that look like this:
File1.fasta
>1
GTCTTCCGGCGAGCGGGCTTTTCACCCGCTTTATCGTTACTTATGTCAGCATTCGCACTT
CTGATACCTCCAGCAACCCTCACAGGCCACCTTCGCAGGCTTACAGAACGCTCCCCTACC
CAACAACGCATAAACGTCGCTGCCGCAGCTTCGGTGCATGGTTTAGCCCCGTTACATCTT
CCGCGCAGGCCGACTCGACCAGTGAGCTATTACGCTTTCTTTAAATGATGGCTGCTTCTA
AGCCAACATCCTGGCTGTCTGG
>2
AAAGAAAGCGTAATAGCTCACTGGTCGAGTCGGCCTGCGCGGAAGATGTAACGGGGCTAA
ACCATGCACCGAAGCTGCGGCAGCGACACTCAGGTGTTGTTGGGTAGGGGAGCGTTCTGT
AAGCCTGTGAAGGTGGCCTGTGAGGGTTGCTGGAGGTATCAGAAGTGCGAATGCTGACAT
AAGTAACGATAAAGCGGGTGAAAAGCCCGCTCGCCGGAAGACCAAGGGTTCCTGTCCAAC
GTTAATCGGGGCAGG
File2.fasta
>1
CAACAACGCATAAACGTCGCTGCCGCAGCTTCGGTGCATGGTTTAGCCCCGTTACATCTT
>2
CCGCGCAGGCCGACTCGACCAGTGAGCTATTACGCTTTCTTTAAATGATGGCTGCTTCTA
With my script, I count all the 5-mers in these files. My code is as follows:
import operator
import glob
def printSeq(name, seq):
kmers = {}
k = 5
for i in range(len(seq) - k + 1):
kmer = seq[i:i+k]
if kmer in kmers:
kmers[kmer] += 1
else:
kmers[kmer] = 1
for kmer, count in kmers.items():
print (kmer + "\t" + str(count))
sortedKmer = sorted(kmers.items(), reverse=True)
for item in sortedKmer:
print (item[0] + "\t" + str(item[1]))
for name in glob.glob('*.fasta'):
with open(name, 'r') as f:
seq = ""
key = ""
for line in f.readlines():
if line.startswith(">"):
if key and seq:
printSeq(key, seq)
key = line[1:].strip()
seq = ""
else:
seq += line.strip()
printSeq(key, seq)
The output is now the 5-mer followed with the count.
I want to adjust my output so that for each output line I get the filename followed by the header and than the count, like this:
File1 1 GTCTT 1
File1 1 TCTTC 1
File1 1 CTTCC 1
....
File2 2 TTCTA 1
How can I achieve that?
Additional question
I want to add the reverse complement sequence of the data and count that together with the previous data. My code to get the reverse complement is as follows
from Bio import SeqIO
for fasta_file in glob.glob('*.fasta'):
for record in SeqIO.parse(fasta_file, "fasta"):
reverse_complement = ">" + record.id + "\n" + record.seq.reverse_complement()
So the "reverse_complement" of file one, header >1 has to be counted together with the previous one etc. How can I include this data to my previous files and count together?
My reverse_complement data is
File1.fasta (reverse_complement)
>1
CCAGACAGCCAGGATGTTGGCTTAGAAGCAGCCATCATTTAAAGAAAGCGTAATAGCTCACTGGTCGAGTCGGCCTGCGCGGAAGATGTAACGGGGCTAAACCATGCACCGAAGCTGCGGCAGCGACGTTTATGCGTTGTTGGGTAGGGGAGCGTTCTGTAAGCCTGCGAAGGTGGCCTGTGAGGGTTGCTGGAGGTATCAGAAGTGCGAATGCTGACATAAGTAACGATAAAGCGGGTGAAAAGCCCGCTCGCCGGAAGAC
>2
CCTGCCCCGATTAACGTTGGACAGGAACCCTTGGTCTTCCGGCGAGCGGGCTTTTCACCCGCTTTATCGTTACTTATGTCAGCATTCGCACTTCTGATACCTCCAGCAACCCTCACAGGCCACCTTCACAGGCTTACAGAACGCTCCCCTACCCAACAACACCTGAGTGTCGCTGCCGCAGCTTCGGTGCATGGTTTAGCCCCGTTACATCTTCCGCGCAGGCCGACTCGACCAGTGAGCTATTACGCTTTCTTT
This could also be done using a Counter() as follows:
from collections import Counter
from itertools import groupby
import glob
for fasta_file in glob.glob('*.fasta'):
basename = os.path.splitext(os.path.basename(fasta_file))[0]
with open(fasta_file) as f_fasta:
for k, g in groupby(f_fasta, lambda x: x.startswith('>')):
if k:
sequence = next(g).strip('>\n')
else:
d = list(''.join(line.strip() for line in g))
counts = Counter()
while len(d) >= 5:
five_mer = '{}{}{}{}{}'.format(d[0], d[1], d[2], d[3], d[4])
counts[five_mer] += 1
del d[0]
for five_mer, count in sorted(counts.items(), key=lambda x: (-x[1], x[0])):
print "{} {} {} {}".format(basename, sequence, five_mer, count)
This would give you output with the largest counts first and then alphabetically:
File1 1 CAGGC 3
File1 1 CGCAG 3
File1 1 GCTTT 3
File1 1 AACGC 2
File1 1 ACATC 2
File1 1 ACGCT 2
File1 1 AGGCC 2
It uses Python's groupby() function to read groups of lines together. It either reads a single sequence line or a list of five mer lines. k is the result of the startswith() call. So when k is False, take all the lines returned, remove the newline from each and then join them together to make a single line of characters.
It then reads the first 5 characters from the list, joins them back together and adds them as a key to a Counter(). It then removes the first character from the list and repeats until there are less than 5 characters remaining.
For just alphabetical ordering:
for five_mer, count in sorted(counts.items()):
A Counter() works the same way as a dictionary, so .items() would give a list of key value pairs. These are sorted before being displayed.
You change the signature of
def printSeq(name, seq)
to
def printSeq(file, header, name, seq):
incorporate the new variables in the print statements.
e.g.
print (item[0] + "\t" + str(item[1]))
v
print (file + "\t" + header + "\t" + item[0] + "\t" + str(item[1]))
Then, in your loop you pass the information to this function.
You have the file name available in the loop, stored in the variable name
You parse the header in the lines where you detect it, and store it in a variable for later use. The later use is when you call the printSeq-function

python script to concatenate values by row and delete identical

I am using python 2.7, and I have a text file that looks like this:
id value
--- ----
1 x
2 a
1 z
1 y
2 b
I am trying to get an ouput that looks like this:
id value
--- ----
1 x,z,y
2 a,b
Much appreciated!
The simplest solution would be to use collections.defaultdict and collections.OrderedDict. If you don't care about order you could also use sets instead of OrderedDict.
from collections import defaultdict, OrderedDict
# Keeps all unique values for each id
dd = defaultdict(OrderedDict)
# Keeps the unique ids in order of appearance
ids = OrderedDict()
with open(yourfilename) as f:
f = iter(f)
# skip first two lines
next(f), next(f)
for line in f:
id_, value = list(filter(bool, line.split())) # split at whitespace and remove empty ones
dd[id_][value] = None # dicts need a value, but here it doesn't matter which one...
ids[id_] = None
print('id value')
print('--- ----')
for id_ in ids:
print('{} {}'.format(id_, ','.join(dd[id_])))
Result:
id value
--- ----
1 x,z,y
2 a,b
In case you want to write it to another file just concatenate what I printed with \n and write it to a file.
I think this could also work, although the other answer seems more sophisticated:
input =['1,x',
'2,a',
'1,z',
'1,y',
'2,b',
'2,a', #added extra values to show duplicates won't be added
'1,z',
'1,y']
output = {}
for row in input:
parts = row.split(",")
id_ = parts[0]
value = parts[1]
if id_ not in output:
output[id_] = value
else:
a_List = list(output[id_])
if value not in a_List:
output[id_] += "," + value
else:
pass
You end up with a dictionary similar to what you requested.
#read
fp=open('','r')
d=fp.read().split("\n")
fp.close()
x=len(d)
for i in range(len(d)):
n= d[i].split()
d.append(n)
d=d[x:]
m={}
for i in d:
if i[0] not in m:
m[i[0]]=[i[1]]
else:
if i[1] not in m[i[0]]:
m[i[0]].append(i[1])
for i in m:
print i,",".join(m[i])

Python File IO - building dictionary and finding max value

Problem is to return the name of the event that has the highest number of participants in this text file:
#Beyond the Imposter Syndrome
32 students
4 faculty
10 industries
#Diversifying Computing Panel
15 students
20 faculty
#Movie Night
52 students
So I figured I had to split it into a dictionary with the keys as the event names and the values as the sum of the integers at the beginning of the other lines. I'm having a lot of trouble and I think I'm making it too complicated than it is.
This is what I have so far:
def most_attended(fname):
'''(str: filename, )'''
d = {}
f = open(fname)
lines = f.read().split(' \n')
print lines
indexes = []
count = 0
for i in range(len(lines)):
if lines[i].startswith('#'):
event = lines[i].strip('#').strip()
if event not in d:
d[event] = []
print d
indexes.append(i)
print indexes
if not lines[i].startswith('#') and indexes !=0:
num = lines[i].strip().split()[0]
print num
if num not in d[len(d)-1]:
d[len(d)-1] += [num]
print d
f.close()
import sys
from collections import defaultdict
from operator import itemgetter
def load_data(file_name):
events = defaultdict(int)
current_event = None
for line in open(file_name):
if line.startswith('#'):
current_event = line[1:].strip()
else:
participants_count = int(line.split()[0])
events[current_event] += participants_count
return events
if __name__ == '__main__':
if len(sys.argv) < 2:
print('Usage:\n\t{} <file>\n'.format(sys.argv[0]))
else:
events = load_data(sys.argv[1])
print('{}: {}'.format(*max(events.items(), key=itemgetter(1))))
Here's how I would do it.
with open("test.txt", "r") as f:
docText = f.read()
eventsList = []
#start at one because we don't want what's before the first #
for item in docText.split("#")[1:]:
individualLines = item.split("\n")
#get the sum by finding everything after the name, name is the first line here
sumPeople = 0
#we don't want the title
for line in individualLines[1:]:
if not line == "":
sumPeople += int(line.split(" ")[0]) #add everything before the first space to the sum
#add to the list a tuple with (eventname, numpeopleatevent)
eventsList.append((individualLines[0], sumPeople))
#get the item in the list with the max number of people
print(max(eventsList, key=lambda x: x[1]))
Essentially you first want to split up the document by #, ignoring the first item because that's always going to be empty. Now you have a list of events. Now for each event you have to go through, and for every additional line in that event (except the first) you have to add that lines value to the sum. Then you create a list of tuples like (eventname) (numPeopleAtEvent). Finally you use max() to get the item with the maximum number of people.
This code prints ('Movie Night', 104) obviously you can format it to however you like
Similar answers to the ones above.
result = {} # store the results
current_key = None # placeholder to hold the current_key
for line in lines:
# find what event we are currently stripping data for
# if this line doesnt start with '#', we can assume that its going to be info for the last seen event
if line.startswith("#"):
current_key = line[1:]
result[current_key] = 0
elif current_key:
# pull the number out of the string
number = [int(s) for s in line.split() if s.isdigit()]
# make sure we actually got a number in the line
if len(number) > 0:
result[current_key] = result[current_key] + number[0]
print(max(result, key=lambda x: x[1]))
This will print "Movie Night".
Your problem description says that you want to find the event with highest number of participants. I tried a solution which does not use list or dictionary.
Ps: I am new to Python.
bigEventName = ""
participants = 0
curEventName = ""
curEventParticipants = 0
# Use RegEx to split the file by lines
itr = re.finditer("^([#\w+].*)$", lines, flags = re.MULTILINE)
for m in itr:
if m.group(1).startswith("#"):
# Whenever a new group is encountered, check if the previous sum of
# participants is more than the recent event. If so, save the results.
if curEventParticipants > participants:
participants = curEventParticipants
bigEventName = curEventName
# Reset the current event name and sum as 0
curEventName = m.group(1)[1:]
curEventParticipants = 0
elif re.match("(\d+) .*", m.group(1)):
# If it is line which starts with number, extract the number and sum it
curEventParticipants += int(re.search("(\d+) .*", m.group(1)).group(1))
# This nasty code is needed to take care of the last event
bigEventName = curEventName if curEventParticipants > participants else bigEventName
# Here is the answer
print("Event: ", bigEventName)
You can do it without a dictionary and maybe make it a little simpler if just using lists:
with open('myfile.txt', 'r') as f:
lines = f.readlines()
lines = [l.strip() for l in lines if l[0] != '#'] # remove comment lines and '\n'
highest = 0
event = ""
for l in lines:
l = l.split()
if int(l[0]) > highest:
highest = int(l[0])
event = l[1]
print (event)

Dictionaries overwriting in Python

This program is to take the grammar rules found in Binary.text and store them into a dictionary, where the rules are:
N = N D
N = D
D = 0
D = 1
but the current code returns D: D = 1, N:N = D, whereas I want N: N D, N: D, D:0, D:1
import sys
import string
#default length of 3
stringLength = 3
#get last argument of command line(file)
filename1 = sys.argv[-1]
#get a length from user
try:
stringLength = int(input('Length? '))
filename = input('Filename: ')
except ValueError:
print("Not a number")
#checks
print(stringLength)
print(filename)
def str2dict(filename="Binary.txt"):
result = {}
with open(filename, "r") as grammar:
#read file
lines = grammar.readlines()
count = 0
#loop through
for line in lines:
print(line)
result[line[0]] = line
print (result)
return result
print (str2dict("Binary.txt"))
Firstly, your data structure of choice is wrong. Dictionary in python is a simple key-to-value mapping. What you'd like is a map from a key to multiple values. For that you'll need:
from collections import defaultdict
result = defaultdict(list)
Next, where are you splitting on '=' ? You'll need to do that in order to get the proper key/value you are looking for? You'll need
key, value = line.split('=', 1) #Returns an array, and gets unpacked into 2 variables
Putting the above two together, you'd go about in the following way:
result = defaultdict(list)
with open(filename, "r") as grammar:
#read file
lines = grammar.readlines()
count = 0
#loop through
for line in lines:
print(line)
key, value = line.split('=', 1)
result[key.strip()].append(value.strip())
return result
Dictionaries, by definition, cannot have duplicate keys. Therefor there can only ever be a single 'D' key. You could, however, store a list of values at that key if you'd like. Ex:
from collections import defaultdict
# rest of your code...
result = defaultdict(list) # Use defaultdict so that an insert to an empty key creates a new list automatically
with open(filename, "r") as grammar:
#read file
lines = grammar.readlines()
count = 0
#loop through
for line in lines:
print(line)
result[line[0]].append(line)
print (result)
return result
This will result in something like:
{"D" : ["D = N D", "D = 0", "D = 1"], "N" : ["N = D"]}

Categories