I have a fastq file like this (part of the file):
#A80HNBABXX:4:1:1344:2224#0/1
AAAACATCAGTATCCATCAGGATCAGTTTGGAAAGGGAGAGGCAATTTTTCCTAAACATGTGTTCAAATGGTCTGAGACAGACGTTAAAATGAAAAGGGG
+
\\YYWX\PX^YT[TVYaTY]^\^H\`^`a`\UZU__TTbSbb^\a^^^`[GOVVXLXMV[Y_^a^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
#A80HNBABXX:4:1:1515:2211#0/1
TTAGAAACTATGGGATTATTCACTCCCTAGGTACTGAGAATGGAAACTTTCTTTGCCTTAATCGTTGACATCCCCTCTTTTAGGTTCTTGCTTCCTAACA
+
ee^e^\`ad`eeee\dd\ddddYeebdd\ddaYbdcYc`\bac^YX[V^\Ybb]]^bdbaZ]ZZ\^K\^]VPNME][`_``Ubb_bYddZbbbYbbYT^_
#A80HNBABXX:4:1:1538:2220#0/1
CTGAGTAAATCATATACTCAATGATTTTTTTATGTGTGTGCATGTGTGCTGTTGATATTCTTCAGTACCAAAACCCATCATCTTATTTGCATAGGGAAGT
+
fff^fd\c^d^Ycac`dcdcded`effdfedb]beeeeecd^ddccdddddfff`eaeeeffdTecacaLV[QRPa\\a\`]aY]ZZ[XYcccYcZ\\]Y
#A80HNBABXX:4:1:1666:2222#0/1
CTGCCAGCACGCTGTCACCTCTCAATAACAGTGAGTGTAATGGCCATACTCTTGATTTGGTTTTTGCCTTATGAATCAGTGGCTAAAAATATTATTTAAT
+
deeee`bbcddddad\bbbbeee\ecYZcc^dd^ddd\\`]``L`ccabaVJ`MZ^aaYMbbb__PYWY]RWNUUab`Y`BBBBBBBBBBBBBBBBBBBB
The FASTQ file uses four lines per sequence. Line 1 begins with a '#' character and is followed by a sequence identifier. Line 2 is the DNA sequence letters. Line 3 begins with a '+' character. Line 4 encodes the quality values for the sequence in Line 2 (the part after "+" and before the next "#", and must contain the same number of symbols as letters in the sequence.
i want to read the fastq file into a dictionary like this (the key is the DNA sequence and the value is the quality value, and the line starting with "#" and "+" can be discarded):
{'AAAACATCAGTATCCATCAGGATCAGTTTGGAAAGGGAGAGGCAATTTTTCCTAAACATGTGTTCAAATGGTCTGAGACAGACGTTAAAATGAAAAGGGG':'\YYWX\PX^YT[TVYaTY]^\^H`^a\UZU__TTbSbb^\a^^^[GOVVXLXMV[Y_^a^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB',
'CTGAGTAAATCATATACTCAATGATTTTTTTATGTGTGTGCATGTGTGCTGTTGATATTCTTCAGTACCAAAACCCATCATCTTATTTGCATAGGGAAGT':'fff^fd\c^d^Ycacdcdcdedeffdfedb]beeeeecd^ddccdddddfffeaeeeffdTecacaLV[QRPa\a`]aY]ZZ[XYcccYcZ\]Y ',
....}
I write the following code but it does not give me what I want. Can anyone help me to fix/improve my code?
class fastq(object):
def __init__(self,filename):
self.filename = filename
self.__sequences = {}
def parse_file(self):
symbol=['#','+']
"""Stores both the sequence and the quality values for the sequence"""
f = open(self.filename,'rU')
for lines in self.filename:
if symbol not in lines.startwith()
data = f.readlines()
return data
Here's a pretty quick and efficient way of doing it:
def parse_file(self):
with open(self.filename, 'r') as f:
content = f.readlines()
# Recreate content without lines that start with # and +
content = [line for line in content if not line[0] in '#+']
# Now the lines you want are alternating, so you can make a dict
# from key/value pairs of lists content[0::2] and content[1::2]
data = dict(zip(content[0::2], content[1::2]))
return data
I don't think use the reads as the key is good idea, what if you got exactly the same read. But any way if you want to do it:
In [9]:
with open('temp.fastq') as f:
lines=f.readlines()
head=[item[:-1] for item in lines[::4]] #get rid of '\n'
read=[item[:-1] for item in lines[1::4]]
qual=[item[:-1] for item in lines[3::4]]
dict(zip(read, qual))
Out[9]:
{'AAAACATCAGTATCCATCAGGATCAGTTTGGAAAGGGAGAGGCAATTTTTCCTAAACATGTGTTCAAATGGTCTGAGACAGACGTTAAAATGAAAAGGGG': '\\\\YYWX\\PX^YT[TVYaTY]^\\^H\\`^`a`\\UZU__TTbSbb^\\a^^^`[GOVVXLXMV[Y_^a^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB',
'CTGAGTAAATCATATACTCAATGATTTTTTTATGTGTGTGCATGTGTGCTGTTGATATTCTTCAGTACCAAAACCCATCATCTTATTTGCATAGGGAAGT': 'fff^fd\\c^d^Ycac`dcdcded`effdfedb]beeeeecd^ddccdddddfff`eaeeeffdTecacaLV[QRPa\\\\a\\`]aY]ZZ[XYcccYcZ\\\\]Y',
'CTGCCAGCACGCTGTCACCTCTCAATAACAGTGAGTGTAATGGCCATACTCTTGATTTGGTTTTTGCCTTATGAATCAGTGGCTAAAAATATTATTTAAT': 'deeee`bbcddddad\\bbbbeee\\ecYZcc^dd^ddd\\\\`]``L`ccabaVJ`MZ^aaYMbbb__PYWY]RWNUUab`Y`BBBBBBBBBBBBBBBBBBBB',
'TTAGAAACTATGGGATTATTCACTCCCTAGGTACTGAGAATGGAAACTTTCTTTGCCTTAATCGTTGACATCCCCTCTTTTAGGTTCTTGCTTCCTAACA': 'ee^e^\\`ad`eeee\\dd\\ddddYeebdd\\ddaYbdcYc`\\bac^YX[V^\\Ybb]]^bdbaZ]ZZ\\^K\\^]VPNME][`_``Ubb_bYddZbbbYbbYT^_'}
you can use function from Bio, like this:
from Bio import SeqIO
myf=mydir+myfile
startlist=[]
for record in SeqIO.parse(myf, "fastq"):
startlist.append(str(record.seq)) #or without 'str'
Related
I want to rewrite a exisiting file with things like:
Tom A
Mike B
Jim C
to
Tom 1
Mike 2
Jim 3
The letters A,B,C can also be something else. Basicaly i want to keep the spaces between the names and what comes behind, but change them to numbers. Does someone have an idea please? Thanks a lot for your help.
I assume your first and second columns are separated by a tab (i.e. \t)?
If so, you can do this by reading the file into a list, use the split function to split each line of the file into components, edit the second component of each line, concatenate the two components back together with a tab separator and finally rewrite to a file.
For example, if test.txt is your input file:
# Create list that holds the desired output
output = [1,2,3]
# Open the file to be overwritten
with open('test.txt', 'r') as f:
# Read file into a list of strings (one string per line)
text = f.readlines()
# Open the file for writing (FYI this CLEARS the file as we specify 'w')
with open('test.txt', 'w') as f:
# Loop over lines (i.e. elements) in `text`
for i,item in enumerate(text):
# Split line into elements based on whitespace (default for `split`)
line = item.split()
# Concatenate the name and desired output with a tab separator and write to the file
f.write("%s\t%s\n" % (line[0],output[i]))
I assumed your first and second columns were separated by a spaces in the file.
You can read the file contents into a list and use the function replace_end(line,newline) and it will replace the end of the line with what you passed. then you can just write out the changed list back to the file.
""" rewrite a exisiting file """
def main():
""" main """
filename = "update_me.txt"
count = 0
lst = []
with open(filename, "r",encoding = "utf-8") as filestream:
_lines = filestream.readlines()
for line in _lines:
lst.insert(count,line.strip())
count += 1
#print(f"Line {count} {line.strip()}")
count = 0
# change the list
for line in lst:
lst[count] = replace_end(line,"ABC")
count +=1
count = 0
with open(filename, "w", encoding = "utf-8") as filestream:
for line in lst:
filestream.write(line+"\n")
count +=1
def replace_end(line,newline):
""" replace the end of a line """
return line[:-len(newline)] + newline
if __name__ == '__main__':
main()
I am trying to do compare two files and extract the sequences which have the subset of others. And, I want to extract the identifiers too. However, what I can do is being able to extract the sequences including subsets. The example files are :
text.fa
>header1
ETTTHAASCISATTVQEQ*TLFRLLP
>header2
SKSPCSDSDY**AAA
>header3
SSGAVAAAPTTA
and,
textref.fa
>textref.fa
CISA
AAAP
AATP
When I run the code, I am having this output :
ETTTHAASCISATTVQEQ*TLFRLLP
SSGAVAAAPTTA
However, my expected output is with headers:
>header1
ETTTHAASCISATTVQEQ*TLFRLLP
>header3
SSGAVAAAPTTA
My code is in two parts, first I create the file with these sequences, and then I try to extract them with their headers from the original fasta file :
def get_nucl(filename):
with open(filename,'r') as fd:
nucl = []
for line in fd:
if line[0]!='>':
nucl.append(line.strip())
return nucl
def finding(filename,reffile):
nucl = get_nucl(filename)
with open(reffile,'r') as reffile2:
for line in reffile2:
for element in nucl:
if line.strip() in element:
yield(element)
with open('sequencesmatched.txt','w') as output:
results = finding('text.fa','textref.fa',)
for res in results:
print(res)
output.write(res + '\n')
So, in this sequencesmatched.txt, I am having the sequences of text.fa that have the substrings of textref.fa. as :
ETTTHAASCISATTVQEQ*TLFRLLP
SSGAVAAAPTTA
So in the other part, to retrieve the respective headers and these sequences :
def finding(filename,seqfile):
with open(filename,'r') as fastafile:
with open(seqfile,'r') as sequf:
alls=[]
for line in fastafile:
alls.append(line.strip())
print(alls)
sequfs = []
for line2 in sequf:
sequfs.append(line2.strip())
if str(line.strip()) == str(line2.strip()):
num = alls.index(line.strip())
print(alls[num-1] + line)
print(finding('text.fa','sequencesmatched.txt'))
However, as an output, I can only retrieve one sequence,which is the first match:
>header1
ETTTHAASCISATTVQEQ*TLFRLLP
Maybe I could do it without the second file, but I could not make the right loops to get the sequences and their respective headers. Therefore, I went to the long way..
I would be happy if you can help!
You can do something much easier if your file is always the same structure:
def get_nucl(filename):
with open(filename, 'r') as fd:
headers = {}
key = ''
for line in fd.readlines():
if '>' in line:
key = line.strip()[1:] # to remove the '>'
else:
headers[key] = line.strip()
return headers
Here i'm assuming your file begin with ">headern" whatever, if not you have to add some test. Now you have a dictionnary like headers['header1'] = 'ETTTHAASCISATTVQEQ*TLFRLLP'.
So now to find the matches you just use that dict :
def finding(filename, reffile):
headers = get_nucl(filename)
with open(reffile, 'r') as f:
matches = {}
for line in f.readlines():
for key, value in headers.items():
if line.stip() in value and key not in matches:
matches[key] = value
return matches
So as you have a dict with headers matching their values, you can just check in the dict if you have a sub string, and you already have the header value as a key.
Just saw you did print(finding(....) , your function already print, so just call it.
I have a text file in which each ID line starts with > and the next line(s) are the a sequence of characters. And the next line after the sequence of characters would be an other ID line starting with >. but in some of them, instead of sequence I have “Sequence unavailable”. The sequence after the ID line can be one or more lines.
like this example:
>ENSG00000173153|ENST00000000442|64073050;64074640|64073208;64074651
AAGCAGCCGGCGGCGCCGCCGAGTGAGGGGACGCGGCGCGGTGGGGCGGCGCGGCCCGAGGAGGCGGCGGAGGAGGGGCCGCCCGCGGCCCCCGGCTCACTCCGGCACTCCGGGCCGCTC
>ENSG00000004139|ENST00000003834
Sequence unavailable
I want to filter out those IDs with “Sequence unavailable”. The output should look like this:
output:
>ENSG00000173153|ENST00000000442|64073050;64074640|64073208;64074651
AAGCAGCCGGCGGCGCCGCCGAGTGAGGGGACGCGGCGCGGTGGGGCGGCGCGGCCCGAGGAGGCGGCGGAGGAGGGGCCGCCCGCGGCCCCCGGCTCACTCCGGCACTCCGGGCCGCTC
do you know how to do that in python?
Unlike the other answers, I’d strongly recommand against parsing the FASTA format manually. It’s not too hard but there are pitfalls, and it’s completely unnecessary since efficient, well-tested implementations exist:
Use Bio.SeqIO from BioPython; for example:
from Bio import SeqIO
for record in SeqIO.parse(filename, 'fasta'):
if record.seq != 'Sequenceunavailable':
SeqIO.write(record, outfile, 'fasta')
Note the missing space in 'Sequenceunavailable': reading the sequences in FASTA format will omit spaces.
How about this:
with open(filename, 'r+') as f:
data = f.read()
data = data.split('>')
result = ['>{}'.format(item) for item in data if item and 'Sequence unavailable' not in item]
f.seek(0)
for line in result:
f.write(line)
def main():
filename = open('text.txt', 'rU').readlines()
filterFile(filename)
def filterFile(SequenceFile):
outfile = open('outfile', 'w')
for line in SequenceFile:
if line.startswith('>'):
sequence = line.next()
if sequence.startswith('Sequence unavailable'):
//nothing should happen I suppose?
else:
outfile.write(line + "\n" + sequence + "\n")
main()
I unfortunately can't test this code right now but I made this out of the top of my head! Please test it and let me know what the outcome is so I can adjust the code :-)
So I don't exactly know how large these files will get, just in case, I'm doing it without mapping the file in memory:
with open(filename) as fh:
with open(filename+'.new', 'w+') as fh_new:
for idline, geneseq in zip(*[iter(fh)] * 2):
if geneseq.strip() != 'Sequence unavailable':
fh_new.write(idline)
fh_new.write(geneseq)
It works by creating a new file, then the zip thing is some magic to read the 2 lines of the file, the idline will be the first part and the geneseq the second part.
This solution should be relatively cheap in computer power but will create an extra output file.
I have to compress a file into a list of words and list of positions to recreate the original file. My program should also be able to take a compressed file and recreate the full text, including punctuation and capitalization, of the original file. I have everything correct apart from the recreation, using the map function my program can't convert my list of positions into floats because of the '[' as it is a list.
My code is:
text = open("speech.txt")
CharactersUnique = []
ListOfPositions = []
DownLine = False
while True:
line = text.readline()
if not line:
break
TwoList = line.split()
for word in TwoList:
if word not in CharactersUnique:
CharactersUnique.append(word)
ListOfPositions.append(CharactersUnique.index(word))
if not DownLine:
CharactersUnique.append("\n")
DownLine = True
ListOfPositions.append(CharactersUnique.index("\n"))
w = open("List_WordsPos.txt", "w")
for c in CharactersUnique:
w.write(c)
w.close()
x = open("List_WordsPos.txt", "a")
x.write(str(ListOfPositions))
x.close()
with open("List_WordsPos.txt", "r") as f:
NewWordsUnique = f.readline()
f.close()
h = open("List_WordsPos.txt", "r")
lines = h.readlines()
NewListOfPositions = lines[1]
NewListOfPositions = map(float, NewListOfPositions)
print("Recreated Text:\n")
recreation = " " .join(NewWordsUnique[pos] for pos in (NewListOfPositions))
print(recreation)
The error I get is:
Task 3 Code.py", line 42, in <genexpr>
recreation = " " .join(NewWordsUnique[pos] for pos in (NewListOfPositions))
ValueError: could not convert string to float: '['
I am using Python IDLE 3.5 (32-bit). Does anyone have any ideas on how to fix this?
Why do you want to turn the position values in the list into floats, since they list indices, and those must be integer? I suspected this might be an instance of what is called the XY Problem.
I also found your code difficult to understand because you haven't followed the PEP 8 - Style Guide for Python Code. In particular, with how many (although not all) of the variable names are CamelCased, which according to the guidelines, should should be reserved for the class names.
In addition some of your variables had misleading names, like CharactersUnique, which actually [mostly] contained unique words.
So, one of the first things I did was transform all the CamelCased variables into lowercase underscore-separated words, like camel_case. In several instances I also gave them better names to reflect their actual contents or role: For example: CharactersUnique became unique_words.
The next step was to improve the handling of files by using Python's with statement to ensure they all would be closed automatically at the end of the block. In other cases I consolidated multiple file open() calls into one.
After all that I had it almost working, but that's when I discovered a problem with the approach of treating newline "\n" characters as separate words of the input text file. This caused a problem when the file was being recreated by the expression:
" ".join(NewWordsUnique[pos] for pos in (NewListOfPositions))
because it adds one space before and after every "\n" character encountered that aren't there in the original file. To workaround that, I ended up writing out the for loop that recreates the file instead of using a list comprehension, because doing so allows the newline "words" could be handled properly.
At any rate, here's the resulting rewritten (and working) code:
input_filename = "speech.txt"
compressed_filename = "List_WordsPos.txt"
# Two lists to represent contents of input file.
unique_words = ["\n"] # preload with newline "word"
word_positions = []
with open(input_filename, "r") as input_file:
for line in input_file:
for word in line.split():
if word not in unique_words:
unique_words.append(word)
word_positions.append(unique_words.index(word))
word_positions.append(unique_words.index("\n")) # add newline at end of each line
# Write representations of the two data-structures to compressed file.
with open(compressed_filename, "w") as compr_file:
words_repr = " ".join(repr(word) for word in unique_words)
compr_file.write(words_repr + "\n")
positions_repr = " ".join(repr(posn) for posn in word_positions)
compr_file.write(positions_repr + "\n")
def strip_quotes(word):
"""Strip the first and last characters from the string (assumed to be quotes)."""
tmp = word[1:-1]
return tmp if tmp != "\\n" else "\n" # newline "words" are special case
# Recreate input file from data in compressed file.
with open(compressed_filename, "r") as compr_file:
line = compr_file.readline()
new_unique_words = list(map(strip_quotes, line.split()))
line = compr_file.readline()
new_word_positions = map(int, line.split()) # using int, not float here
words = []
lines = []
for posn in new_word_positions:
word = new_unique_words[posn]
if word != "\n":
words.append(word)
else:
lines.append(" ".join(words))
words = []
print("Recreated Text:\n")
recreation = "\n".join(lines)
print(recreation)
I created my own speech.txt test file from the first paragraph of your question and ran the script on it with these results:
Recreated Text:
I have to compress a file into a list of words and list of positions to recreate
the original file. My program should also be able to take a compressed file and
recreate the full text, including punctuation and capitalization, of the
original file. I have everything correct apart from the recreation, using the
map function my program can't convert my list of positions into floats because
of the '[' as it is a list.
Per your question in the comments:
You will want to split the input on spaces. You will also likely want to use different data structures.
# we'll map the words to a list of positions
all_words = {}
with open("speech.text") as f:
data = f.read()
# since we need to be able to re-create the file, we'll want
# line breaks
lines = data.split("\n")
for i, line in enumerate(lines):
words = line.split(" ")
for j, word in enumerate(words):
if word in all_words:
all_words[word].append((i, j)) # line and pos
else:
all_words[word] = [(i, j)]
Note that this does not yield maximum compression as foo and foo. count as separate words. If you want more compression, you'll have to go character by character. Hopefully now you can use a similar approach to do so if desired.
I'm writing a short program in Python that will read a FASTA file which is usually in this format:
>gi|253795547|ref|NC_012960.1| Candidatus Hodgkinia cicadicola Dsem chromosome, 52 lines
GACGGCTTGTTTGCGTGCGACGAGTTTAGGATTGCTCTTTTGCTAAGCTTGGGGGTTGCGCCCAAAGTGA
TTAGATTTTCCGACAGCGTACGGCGCGCGCTGCTGAACGTGGCCACTGAGCTTACACCTCATTTCAGCGC
TCGCTTGCTGGCGAAGCTGGCAGCAGCTTGTTAATGCTAGTGTTGGGCTCGCCGAAAGCTGGCAGGTCGA
I've created another program that reads the first line(aka header) of this FASTA file and now I want this second program to start reading and printing beginning from the sequence.
How would I do that?
so far i have this:
FASTA = open("test.txt", "r")
def readSeq(FASTA):
"""returns the DNA sequence of a FASTA file"""
for line in FASTA:
line = line.strip()
print line
readSeq(FASTA)
Thanks guys
-Noob
def readSeq(FASTA):
"""returns the DNA sequence of a FASTA file"""
_unused = FASTA.next() # skip heading record
for line in FASTA:
line = line.strip()
print line
Read the docs on file.next() to see why you should be wary of mixing file.readline() with for line in file:
you should show your script. To read from second line, something like this
f=open("file")
f.readline()
for line in f:
print line
f.close()
You might be interested in checking BioPythons handling of Fasta files (source).
def FastaIterator(handle, alphabet = single_letter_alphabet, title2ids = None):
"""Generator function to iterate over Fasta records (as SeqRecord objects).
handle - input file
alphabet - optional alphabet
title2ids - A function that, when given the title of the FASTA
file (without the beginning >), will return the id, name and
description (in that order) for the record as a tuple of strings.
If this is not given, then the entire title line will be used
as the description, and the first word as the id and name.
Note that use of title2ids matches that of Bio.Fasta.SequenceParser
but the defaults are slightly different.
"""
#Skip any text before the first record (e.g. blank lines, comments)
while True:
line = handle.readline()
if line == "" : return #Premature end of file, or just empty?
if line[0] == ">":
break
while True:
if line[0]!=">":
raise ValueError("Records in Fasta files should start with '>' character")
if title2ids:
id, name, descr = title2ids(line[1:].rstrip())
else:
descr = line[1:].rstrip()
id = descr.split()[0]
name = id
lines = []
line = handle.readline()
while True:
if not line : break
if line[0] == ">": break
#Remove trailing whitespace, and any internal spaces
#(and any embedded \r which are possible in mangled files
#when not opened in universal read lines mode)
lines.append(line.rstrip().replace(" ","").replace("\r",""))
line = handle.readline()
#Return the record and then continue...
yield SeqRecord(Seq("".join(lines), alphabet),
id = id, name = name, description = descr)
if not line : return #StopIteration
assert False, "Should not reach this line"
good to see another bioinformatician :)
just include an if clause within your for loop above the line.strip() call
def readSeq(FASTA):
for line in FASTA:
if line.startswith('>'):
continue
line = line.strip()
print(line)
A pythonic and simple way to do this would be slice notation.
>>> f = open('filename')
>>> lines = f.readlines()
>>> lines[1:]
['TTAGATTTTCCGACAGCGTACGGCGCGCGCTGCTGAACGTGGCCACTGAGCTTACACCTCATTTCAGCGC\n', 'TCGCTTGCTGGCGAAGCTGGCAGCAGCTTGTTAATGCTAGTG
TTGGGCTCGCCGAAAGCTGGCAGGTCGA']
That says "give me all elements of lines, from the second (index 1) to the end.
Other general uses of slice notation:
s[i:j] slice of s from i to j
s[i:j:k] slice of s from i to j with step k (k can be negative to go backward)
Either i or j can be omitted (to imply the beginning or the end), and j can be negative to indicate a number of elements from the end.
s[:-1] All but the last element.
Edit in response to gnibbler's comment:
If the file is truly massive you can use iterator slicing to get the same effect while making sure you don't get the whole thing in memory.
import itertools
f = open("filename")
#start at the second line, don't stop, stride by one
for line in itertools.islice(f, 1, None, 1):
print line
"islicing" doesn't have the nice syntax or extra features of regular slicing, but it's a nice approach to remember.