We Keep Coding

How to store first N strings from a txt file in Python?

I'm trying to figure out how to get the first N strings from a txt file, and store them into an array. Right now, I have code that gets every string from a txt file, separated by a space delimiter, and stores it into an array. However, I want to be able to only grab the first N number of strings from it, not every single string. Here is my code (and I'm doing it from a command prompt):
import sys
f = open(sys.argv[1], "r")
contents = f.read().split(' ')
f.close()
I'm sure that the only line I need to fix is:
contents = f.read().split(' ')
I'm just not sure how to limit it here to N number of strings.

If the file is really big, but not too big--that is, big enough that you don't want to read the whole file (especially in text mode or as a list of lines), but not so big that you can't page it into memory (which means under 2GB on a 32-bit OS, but a lot more on 64-bit), you can do this:
import itertools
import mmap
import re
import sys
n = 5
# Notice that we're opening in binary mode. We're going to do a
# bytes-based regex search. This is only valid if (a) the encoding
# is ASCII-compatible, and (b) the spaces are ASCII whitespace, not
# other Unicode whitespace.
with open(sys.argv[1], 'rb') as f:
# map the whole file into memory--this won't actually read
# more than a page or so beyond the last space
m = mmap.mmap(f.fileno(), access=mmap.ACCESS_READ)
# match and decode all space-separated words, but do it lazily...
matches = re.finditer(r'(.*?)\s', m)
bytestrings = (match.group(1) for match in matches)
strings = (b.decode() for b in bytestrings)
# ... so we can stop after 5 of them ...
nstrings = itertools.islice(strings, n)
# ... and turn that into a list of the first 5
contents = list(nstrings)
Obviously you can combine steps together, even cramming the whole thing into a giant one-liner if you want. (An idiomatic version would be somewhere between that extreme and this one.)

If you're fine with reading the whole file (assuming it's not memory prohibitive to do so) you can just do this:
strings_wanted = 5
strings = open('myfile').read().split()[:strings_wanted]
That works like this:
>>> s = 'this is a test string with more than five words.'
>>> s.split()[:5]
['this', 'is', 'a', 'test', 'string']

If you actually want to stop reading exactly as soon as you've reached the nth word, you pretty much have to read a byte at a time. But that's going to be slow, and complicated. Plus, it's still not really going to stop reading after the nth word, unless you're reading in binary mode and decoding manually, and you disable buffering.
As long as the text file has line breaks (as opposed to being one giant 80MB line), and it's acceptable to read a few bytes past the nth word, a very simple solution will still be pretty efficient: just read and split line by line:
import sys
f = open(sys.argv[1], "r")
contents = []
for line in f:
contents += line.split()
if len(contents) >= n:
del contents[n:]
break
f.close()

what about just:
output=input[:3]
output will contain the first three strings in input

Python: losing nucleotides from fasta file to dictionary

I am trying to write a code to extract longest ORF in a fasta file. It is from Coursera Genomics data science course.
the file is a practice file: "dna.example.fasta"
Data is here:https://d396qusza40orc.cloudfront.net/genpython/data_sets/dna.example.fasta
Part of my code is below to extract reading frame 2 (start from the second position of a sequence. eg: seq: ATTGGG, to get reading frame 2: TTGGG):
#!/usr/bin/python
import sys
import getopt
o, a = getopt.getopt(sys.argv[1:], 'h')
opts = dict()
for k,v in o:
opts[k] = v
if '-h' in k:
print "--help\n"
if len(a) < 0:
print "missing fasta file\n"
f = open(a[0], "r")
seq = dict()
for line in f:
line = line.strip()
if line.startswith(">"):
name = line.split()[0]
seq[name] = ''
else:
seq[name] = seq[name] + line[1:]
k = seq[">gi|142022655|gb|EQ086233.1|323"]
print len(k)
The length of this particular sequence should be 4804 bp. Therefore by using this sequence alone I could get the correct answer.
However, with the code, here in the dictionary, this particular sequence becomes only 4736 bp.
I am new to python, so I can not wrap my head around as to where did those 100 bp go?
Thank you,
Xio

Take another look at your data file
An example of some of the lines:
>gi|142022655|gb|EQ086233.1|43 marine metagenome JCVI_SCAF_1096627390048 genomic scaffold, whole genome shotgun sequence
TCGGGCGAAGGCGGCAGCAAGTCGTCCACGCGCAGCGCGGCACCGCGGGCCTCTGCCGTGCGCTGCTTGG
CCATGGCCTCCAGCGCACCGATCGGATCAAAGCCGCTGAAGCCTTCGCGCATCAGGCGGCCATAGTTGGC
Notice how the sequences start on the first value of each line.
Your addition line seq[name] = seq[name] + line[1:] is adding everything on that line after the first character, excluding the first (Python 2 indicies are zero based). It turns out your missing number of nucleotides is the number of lines it took to make that genome, because you're losing the first character every time.
The revised way is seq[name] = seq[name] + line which simply adds the line without losing that first character.
The quickest way to find these kind of debugging errors is to either use a formal debugger, or add a bunch of print statements on your code and test with a small portion of the file -- something that you can see the output of and check for yourself if it's coming out right. A short file with maybe 50 nucleotides instead of 5000 is much easier to evaluate by hand and make sure the code is doing what you want. That's what I did to come up with the answer to the problem in about 5 minutes.
Also for future reference, please mention the version of python you are using before hand. There are quite a few differences between python 2 (The one you're using) and python 3.
I did some additional testing with your code, and if you get any extra characters at the end, they might be whitespace. Make sure you use the .strip() method on each line before adding it to your string, which clears whitespace.
Addressing your comment,
To start from the 2nd position on the first line of the sequence only and then use the full lines until the following nucleotide, you can take advantage of the file's linear format and just add one more clause to your if statement, an elif. This will test if we're on the first line of the sequence, and if so, use the characters starting from the second, if we're on any other line, use the whole line.
if line.startswith(">"):
name = line.split()[0]
seq[name] = ''
#If it's the first line in the series, then the dict's value
# will be an empty string, so this elif means "If we're at the
# start of the series..."
elif seq[name] == '':
seq[name] = seq[name] + line[1:]
else:
seq[name] = seq[name]
This adaptation will start from the 2nd nucleotide in the genome without losing the first from every line in the rest of the nucleotide.

Having problems with strings and arrays

I want to read a text file and copy text that is in between '~~~~~~~~~~~~~' into an array. However, I'm new in Python and this is as far as I got:
with open("textfile.txt", "r",encoding='utf8') as f:
searchlines = f.readlines()
a=[0]
b=0
for i,line in enumerate(searchlines):
if '~~~~~~~~~~~~~' in line:
b=b+1
if '~~~~~~~~~~~~~' not in line:
if 's1mb4d' in line:
break
a.insert(b,line)
This is what I envisioned:
First I read all the lines of the text file,
then I declare 'a' as an array in which text should be added,
then I declare 'b' because I need it as an index. The number of lines in between the '~~~~~~~~~~~~~' is not even, that's why I use 'b' so I can put lines of text into one array index until a new '~~~~~~~~~~~~~' was found.
I check for '~~~~~~~~~~~~~', if found I increase 'b' so I can start adding lines of text into a new array index.
The text file ends with 's1mb4d', so once its found, the program ends.
And if '~~~~~~~~~~~~~' is not found in the line, I add text to the array.
But things didn't go well. Only 1 line of the entire text between those '~~~~~~~~~~~~~' is being copied to the each array index.
Here is an example of the text file:
~~~~~~~~~~~~~
Text123asdasd
asdasdjfjfjf
~~~~~~~~~~~~~
123abc
321bca
gjjgfkk
~~~~~~~~~~~~~

You could use regex expression, give a try to this:
import re
input_text = ['Text123asdasd asdasdjfjfjf','~~~~~~~~~~~~~','123abc 321bca gjjgfkk','~~~~~~~~~~~~~']
a = []
for line in input_text:
my_text = re.findall(r'[^\~]+', line)
if len(my_text) != 0:
a.append(my_text)
What it does is it reads line by line looks for all characters but '~' if line consists only of '~' it ignores it, every line with text is appended to your a list afterwards.
And just because we can, oneliner (excluding import and source ofc):
import re
lines = ['Text123asdasd asdasdjfjfjf','~~~~~~~~~~~~~','123abc 321bca gjjgfkk','~~~~~~~~~~~~~']
a = [re.findall(r'[^\~]+', line) for line in lines if len(re.findall(r'[^\~]+', line)) != 0]

In python the solution to a large part of problems is often to find the right function from the standard library that does the job. Here you should try using split instead, it should be way easier.
If I understand correctly your goal, you can do it like that :
joined_lines = ''.join(searchlines)
result = joined_lines.split('~~~~~~~~~~')
The first line joins your list of lines into a sinle string, and then the second one cut that big string every times it encounters the '~~' sequence.

I tried to clean it up to the best of my knowledge, try this and let me know if it works. We can work together on this!:)
with open("textfile.txt", "r",encoding='utf8') as f:
searchlines = f.readlines()
a = []
currentline = ''
for i,line in enumerate(searchlines):
currentline += line
if '~~~~~~~~~~~~~' in line:
a.append(currentline)
elif 's1mb4d' in line:
break
Some notes:
You can use elif for your break function
Append will automatically add the next iteration to the end of the array
currentline will continue to add text on each line as long as it doesn't have 's1mb4d' or the ~~~ which I think is what you want

s = ['']
with open('path\\to\\sample.txt') as f:
for l in f:
a = l.strip().split("\n")
s += a
a = []
for line in s:
my_text = re.findall(r'[^\~]+', line)
if len(my_text) != 0:
a.append(my_text)
print a
>>> [['Text123asdasd asdasdjfjfjf'], ['123abc 321bca gjjgfkk']]

If you're willing to impose/accept the constraint that the separator should be exactly 13 ~ characters (actually '\n%s\n' % ( '~' * 13) to be specific) ...
then you could accomplish this for relatively normal sized files using just
#!/usr/bin/python
## (Should be #!/usr/bin/env python; but StackOverflow's syntax highlighter?)
separator = '\n%s\n' % ('~' * 13)
with open('somefile.txt') as f:
results = f.read().split(separator)
# Use your results, a list of the strings separated by these separators.
Note that '~' * 13 is a way, in Python, of constructing a string by repeating some smaller string thirteen times. 'xx%sxx' % 'YY' is a way to "interpolate" one string into another. Of course you could just paste the thirteen ~ characters into your source code ... but I would consider constructing the string as shown to make it clear that the length is part of the string's specification --- that this is part of your file format requirements ... and that any other number of ~ characters won't be sufficient.
If you really want any line of any number of ~ characters to serve as a separator than you'll want to use the .split() method from the regular expressions module rather than the .split() method provided by the built-in string objects.
Note that this snippet of code will return all of the text between your separator lines, including any newlines they include. There are other snippets of code which can filter those out. For example given our previous results:
# ... refine results by filtering out newlines (replacing them with spaces)
results = [' '.join(each.split('\n')) for each in results]
(You could also use the .replace() string method; but I prefer the join/split combination). In this case we're using a list comprehension (a feature of Python) to iterate over each item in our results, which we're arbitrarily naming each), performing our transformation on it, and the resulting list is being boun back to the name results; I highly recommend learning and getting comfortable with list comprehension if you're going to learn Python. They're commonly used and can be a bit exotic compared to the syntax of many other programming and scripting languages).
This should work on MS Windows as well as Unix (and Unix-like) systems because of how Python handles "universal newlines." To use these examples under Python 3 you might have to work a little on the encodings and string types. (I didn't need to for my Python3.6 installed under MacOS X using Homebrew ... but just be forewarned).

How to convert a list into float for using the '.join' function?

I have to compress a file into a list of words and list of positions to recreate the original file. My program should also be able to take a compressed file and recreate the full text, including punctuation and capitalization, of the original file. I have everything correct apart from the recreation, using the map function my program can't convert my list of positions into floats because of the '[' as it is a list.
My code is:
text = open("speech.txt")
CharactersUnique = []
ListOfPositions = []
DownLine = False
while True:
line = text.readline()
if not line:
break
TwoList = line.split()
for word in TwoList:
if word not in CharactersUnique:
CharactersUnique.append(word)
ListOfPositions.append(CharactersUnique.index(word))
if not DownLine:
CharactersUnique.append("\n")
DownLine = True
ListOfPositions.append(CharactersUnique.index("\n"))
w = open("List_WordsPos.txt", "w")
for c in CharactersUnique:
w.write(c)
w.close()
x = open("List_WordsPos.txt", "a")
x.write(str(ListOfPositions))
x.close()
with open("List_WordsPos.txt", "r") as f:
NewWordsUnique = f.readline()
f.close()
h = open("List_WordsPos.txt", "r")
lines = h.readlines()
NewListOfPositions = lines[1]
NewListOfPositions = map(float, NewListOfPositions)
print("Recreated Text:\n")
recreation = " " .join(NewWordsUnique[pos] for pos in (NewListOfPositions))
print(recreation)
The error I get is:
Task 3 Code.py", line 42, in <genexpr>
recreation = " " .join(NewWordsUnique[pos] for pos in (NewListOfPositions))
ValueError: could not convert string to float: '['
I am using Python IDLE 3.5 (32-bit). Does anyone have any ideas on how to fix this?

Why do you want to turn the position values in the list into floats, since they list indices, and those must be integer? I suspected this might be an instance of what is called the XY Problem.
I also found your code difficult to understand because you haven't followed the PEP 8 - Style Guide for Python Code. In particular, with how many (although not all) of the variable names are CamelCased, which according to the guidelines, should should be reserved for the class names.
In addition some of your variables had misleading names, like CharactersUnique, which actually [mostly] contained unique words.
So, one of the first things I did was transform all the CamelCased variables into lowercase underscore-separated words, like camel_case. In several instances I also gave them better names to reflect their actual contents or role: For example: CharactersUnique became unique_words.
The next step was to improve the handling of files by using Python's with statement to ensure they all would be closed automatically at the end of the block. In other cases I consolidated multiple file open() calls into one.
After all that I had it almost working, but that's when I discovered a problem with the approach of treating newline "\n" characters as separate words of the input text file. This caused a problem when the file was being recreated by the expression:
" ".join(NewWordsUnique[pos] for pos in (NewListOfPositions))
because it adds one space before and after every "\n" character encountered that aren't there in the original file. To workaround that, I ended up writing out the for loop that recreates the file instead of using a list comprehension, because doing so allows the newline "words" could be handled properly.
At any rate, here's the resulting rewritten (and working) code:
input_filename = "speech.txt"
compressed_filename = "List_WordsPos.txt"
# Two lists to represent contents of input file.
unique_words = ["\n"] # preload with newline "word"
word_positions = []
with open(input_filename, "r") as input_file:
for line in input_file:
for word in line.split():
if word not in unique_words:
unique_words.append(word)
word_positions.append(unique_words.index(word))
word_positions.append(unique_words.index("\n")) # add newline at end of each line
# Write representations of the two data-structures to compressed file.
with open(compressed_filename, "w") as compr_file:
words_repr = " ".join(repr(word) for word in unique_words)
compr_file.write(words_repr + "\n")
positions_repr = " ".join(repr(posn) for posn in word_positions)
compr_file.write(positions_repr + "\n")
def strip_quotes(word):
"""Strip the first and last characters from the string (assumed to be quotes)."""
tmp = word[1:-1]
return tmp if tmp != "\\n" else "\n" # newline "words" are special case
# Recreate input file from data in compressed file.
with open(compressed_filename, "r") as compr_file:
line = compr_file.readline()
new_unique_words = list(map(strip_quotes, line.split()))
line = compr_file.readline()
new_word_positions = map(int, line.split()) # using int, not float here
words = []
lines = []
for posn in new_word_positions:
word = new_unique_words[posn]
if word != "\n":
words.append(word)
else:
lines.append(" ".join(words))
words = []
print("Recreated Text:\n")
recreation = "\n".join(lines)
print(recreation)
I created my own speech.txt test file from the first paragraph of your question and ran the script on it with these results:
Recreated Text:
I have to compress a file into a list of words and list of positions to recreate
the original file. My program should also be able to take a compressed file and
recreate the full text, including punctuation and capitalization, of the
original file. I have everything correct apart from the recreation, using the
map function my program can't convert my list of positions into floats because
of the '[' as it is a list.

Per your question in the comments:
You will want to split the input on spaces. You will also likely want to use different data structures.
# we'll map the words to a list of positions
all_words = {}
with open("speech.text") as f:
data = f.read()
# since we need to be able to re-create the file, we'll want
# line breaks
lines = data.split("\n")
for i, line in enumerate(lines):
words = line.split(" ")
for j, word in enumerate(words):
if word in all_words:
all_words[word].append((i, j)) # line and pos
else:
all_words[word] = [(i, j)]
Note that this does not yield maximum compression as foo and foo. count as separate words. If you want more compression, you'll have to go character by character. Hopefully now you can use a similar approach to do so if desired.

complex regex matches in python

I have a txt file that contains the following data:
chrI
ATGCCTTGGGCAACGGT...(multiple lines)
chrII
AGGTTGGCCAAGGTT...(multiple lines)
I want to first find 'chrI' and then iterate through the multiple lines of ATGC until I find the xth char. Then I want to print the xth char until the yth char. I have been using regex but once I have located the line containing chrI, I don't know how to continue iterating to find the xth char.
Here is my code:
for i, line in enumerate(sacc_gff):
for match in re.finditer(chromo_val, line):
print(line)
for match in re.finditer(r"[ATGC]{%d},{%d}\Z" % (int(amino_start), int(amino_end)), line):
print(match.group())
What the variables mean:
chromo_val = chrI
amino_start = (some start point my program found)
amino_end = (some end point my program found)
Note: amino_start and amino_end need to be in variable form.
Please let me know if I could clarify anything for you, Thank you.

It looks like you are working with fasta data, so I will provide an answer with that in mind, but if it isn't you can use the sub_sequence selection part still.
fasta_data = {} # creates an empty dictionary
with open( fasta_file, 'r' ) as fh:
for line in fh:
if line[0] == '>':
seq_id = line.rstrip()[1:] # strip newline character and remove leading '>' character
fasta_data[seq_id] = ''
else:
fasta_data[seq_id] += line.rstrip()
# return substring from chromosome 'chrI' with a first character at amino_start up to but not including amino_end
sequence_string1 = fasta_data['chrI'][amino_start:amino_end]
# return substring from chromosome 'chrII' with a first character at amino_start up to and including amino_end
sequence_string2 = fasta_data['chrII'][amino_start:amino_end+1]
fasta format:
>chr1
ATTTATATATAT
ATGGCGCGATCG
>chr2
AATCGCTGCTGC

Since you are working with fasta files which are formatted like this:
>Chr1
ATCGACTACAAATTT
>Chr2
ACCTGCCGTAAAAATTTCC
and are a bioinformatics major I am guessing you will be manipulating sequences often I recommend install the perl package called FAST. Once this is installed to get the 2-14 character of every sequence you would do this:
fascut 2..14 fasta_file.fa
Here is the recent publication for FAST and github that contains a whole toolbox for manipulating molecule sequence data on the command line.