So, I am working with a text file on which I am doing the following operations on the string
def string_operations(string):
1) lowercase
2) remove integers from string
3) remove symbols
4) stemming
After this, I am still left with strings like:
durham 28x23
I see the flaw in my approach but would like to know if there is a good, fast way to identify if there is a numeric value attached with the string.
So in the above example, I want the output to be
durham
Another example:
21st ammendment
Should give:
ammendment
So how do I deal with this stuff?
If you requirement is, "remove any terms that start with a digit", you could do something like this:
def removeNumerics(s):
return ' '.join([term for term in s.split() if not term[0].isdigit()])
This splits the string on whitespace and then joins with a space all the terms that do not start with a number.
And it works like this:
>>> removeNumerics('21st amendment')
'amendment'
>>> removeNumerics('durham 28x23')
'durham'
If this isn't what you're looking for, maybe show some explicit examples in your questions (showing both the initial string and your desired result).
Related
I have the following code:
dna = "TGCGAGAAGGGGCGATCATGGAGATCTACTATCCTCTCGGGGTATGGTGGGGTTGAGA"
print(dna.count("GAGA"))
dna = dna.replace("GAGA", "AGAG")
print(dna.count("GAGA"))
Replace does not replace all occurrences. Could somebody help my in understanding why it happened?
It replaces all occurences. That might lead to new occurences (look at your replacement string!).
I'd say, logically, all is fine.
You could repeat this replace while dna.count("GAGA") > 0 , but: that sounds not like what you should be doing. (I bet you really just want to do one round of replacement to simulate something specific happening. Not a genetics expert at all though.)
It did make all replacements (that's what .replace() does in Python unless specified otherwise), but some of these replacements inadvertently introduced new instances of GAGA. Take the beginning of your string:
TGCGAGAA
There's GAGA at indices 3-6. If you replace that with AGAG, you get
TGCAGAGA
So the last G from that AGAG, together with the subsequent A that was already there before, forms a new GAGA.
Replacements does not occur "until exhausted"; they occur when a substring is matched in your original string.
Consider the following from your string:
>>> a = "TGCGAGAA"
>>> a.replace("GAGA", "AGAG")
'TGCAGAGA'
>>>
The replacement does not happen again, since the original string did not match GAGA in that location.
If you want to do the replacement until no match is found, you can wrap it in a loop:
>>> while a.count("GAGA") > 0: # you probably don't want to use count here if the string is long because of performance considerations
... a = a.replace("GAGA", "AGAG")
...
>>> a
'TGCAAGAG'
I would like to replace all substring occurrences with regular expressions. The original sentences would be like:
mystring = "Carl's house is big. He is asking 1M for that(the house)."
Now let's suppose I have two substrings I would like to bold. I bold the words by adding ** at the beginning and at the end of the substring. The 2 substrings are:
substring1 = "house", so bolded it would be "**house**"
substring2 = "the house", so bolded it would be "**the house**"
At the end I want the original sentence like this:
mystring = "Carl's **house** is big. He is asking 1M for that(**the house**)."
The main problem is that as I have several substrings to replace, they can overlap words like the example above. If I analyze the longest substring at first, I am getting this:
Carl's **house** is big. He is asking 1M for that(**the **house****).
On the other hand, if I analyze the shortest substring first, I am getting this:
Carl's **house** is big. He is asking 1M for that(the **house**).
It seems to be I will need to replace from the longest substring to the shortest, but I wonder how should I do to consider it in the first replacement but in the second. Also remember the substring can appear several times in the string.
Note:// Suppose the string ** will never occur in the original string, so we can use it to bold our words
You can search for all of the strings at once, so that the fact that one is a substring of another doesn't matter:
re.sub(r"(house|the house)", r"**\1**", mystring)
You could have a group that is not captured and is note required. If you look at the regex patter (?P<repl>(?:the )?house), the (?:the )? part is saying that there might be a the in the string, if it is present, include it in the match. This way, you let the re library optimize the way it matches. Here is the complete example
>>> data = "Carl's house is big. He is asking 1M for that(the house)."
>>> re.sub('(?P<repl>(?:the )?house)', '**\g<repl>**', data)
"Carl's **house** is big. He is asking 1M for that(**the house**)."
Note: \g<repl> is used to get all the string matched by the group <repl>
You could do two passes:
First: Go through from longest to shortest and replace with something like:
'the house': 'AA_THE_HOUSE'
'house': 'BB_HOUSE'
Second: Go through replace like:
'AA_THE_HOUSE': '**the house**'
'BB_HOUSE': '**house**'
Replace the strings with some unique values and then replace them back with original string enclosed in ** to make them bold.
For example:
'the house' with 'temp_the_house'
'house' with 'temp_house'
then 'temp_house' with 'house'
'temp_the_house' with '**the house****'
Should work fine. You can automate this by using two lists.
I want to do the following split:
input: 0x0000007c9226fc output: 7c9226fc
input: 0x000000007c90e8ab output: 7c90e8ab
input: 0x000000007c9220fc output: 7c9220fc
I use the following line of code to do this but it does not work!
split = element.rpartition('0')
I got these outputs which are wrong!
input: 0x000000007c90e8ab output: e8ab
input: 0x000000007c9220fc output: fc
what is the fastest way to do this kind of split?
The only idea for me right now is to make a loop and perform checking but it is a little time consuming.
I should mention that the number of zeros in input is not fixed.
Each string can be converted to an integer using int() with a base of 16. Then convert back to a string.
for s in '0x000000007c9226fc', '0x000000007c90e8ab', '0x000000007c9220fc':
print '%x' % int(s, 16)
Output
7c9226fc
7c90e8ab
7c9220fc
input[2:].lstrip('0')
That should do it. The [2:] skips over the leading 0x (which I assume is always there), then the lstrip('0') removes all the zeros from the left side.
In fact, we can use lstrip ability to remove more than one leading character to simplify:
input.lstrip('x0')
format is handy for this:
>>> print '{:x}'.format(0x000000007c90e8ab)
7c90e8ab
>>> print '{:x}'.format(0x000000007c9220fc)
7c9220fc
In this particular case you can just do
your_input[10:]
You'll most likely want to properly parse this; your idea of splitting on separation of non-zero does not seem safe at all.
Seems to be the XY problem.
If the number of characters in a string is constant then you can use
the following code.
input = "0x000000007c9226fc"
output = input[10:]
Documentation
Also, since you are using rpartitionwhich is defined as
str.rpartition(sep)
Split the string at the last occurrence of sep, and return a 3-tuple containing the part before the separator, the separator itself, and the part after the separator. If the separator is not found, return a 3-tuple containing two empty strings, followed by the string itself.
Since your input can have multiple 0's, and rpartition only splits the last occurrence this a malfunction in your code.
Regular expression for 0x00000 or its type is (0x[0]+) and than replace it with space.
import re
st="0x000007c922433434000fc"
reg='(0x[0]+)'
rep=re.sub(reg, '',st)
print rep
So I'm working on a problem where I have to find various string repeats after encountering an initial string, say we take ACTGAC so the data file has sequences that look like:
AAACTGACACCATCGATCAGAACCTGA
So in that string once we find ACTGAC then I need to analyze the next 10 characters for the string repeats which go by some rules. I have the rules coded but can anyone show me how once I find the string that I need, I can make a substring for the next ten characters to analyze. I know that str.partition function can do that once I find the string, and then the [1:10] can get the next ten characters.
Thanks!
You almost have it already (but note that indexes start counting from zero in Python).
The partition method will split a string into head, separator, tail, based on the first occurence of separator.
So you just need to take a slice of the first ten characters of the tail:
>>> data = 'AAACTGACACCATCGATCAGAACCTGA'
>>> head, sep, tail = data.partition('ACTGAC')
>>> tail[:10]
'ACCATCGATC'
Python allows you to leave out the start-index in slices (in defaults to zero - the start of the string), and also the end-index (it defaults to the length of the string).
Note that you could also do the whole operation in one line, like this:
>>> data.partition('ACTGAC')[2][:10]
'ACCATCGATC'
So, based on marcog's answer in Find all occurrences of a substring in Python , I propose:
>>> import re
>>> data = 'AAACTGACACCATCGATCAGAACCTGAACTGACTGACAAA'
>>> sep = 'ACTGAC'
>>> [data[m.start()+len(sep):][:10] for m in re.finditer('(?=%s)'%sep, data)]
['ACCATCGATC', 'TGACAAA', 'AAA']
I need to create a regexp to match strings like this 999-123-222-...-22
The string can be finished by &Ns=(any number) or without this... So valid strings for me are
999-123-222-...-22
999-123-222-...-22&Ns=12
999-123-222-...-22&Ns=12
And following are not valid:
999-123-222-...-22&N=1
I have tried testing it several hours already... But did not manage to solve, really need some help
Not sure if you want to literally match 999-123-22-...-22 or if that can be any sequence of numbers/dashes. Here are two different regexes:
/^[\d-]+(&Ns=\d+)?$/
/^999-123-222-\.\.\.-22(&Ns=\d+)?$/
The key idea is the (&Ns=\d+)?$ part, which matches an optional &Ns=<digits>, and is anchored to the end of the string with $.
If you just want to allow strings 999-123-222-...-22 and 999-123-222-...-22&Ns=12 you better use a string function.
If you want to allow any numbers between - you can use the regex:
^(\d+-){3}[.]{3}-\d+(&Ns=\d+)?$
If the numbers must be of only 3 digits and the last number of only 2 digits you can use:
^(\d{3}-){3}[.]{3}-\d{2}(&Ns=\d{2})?$
This looks like a phone number and extension information..
Why not make things simpler for yourself (and anyone who has to read this later) and split the input rather than use a complicated regex?
s = '999-123-222-...-22&Ns=12'
parts = s.split('&Ns=') # splits on Ns and removes it
If the piece before the "&" is a phone number, you could do another split and get the area code etc into separate fields, like so:
phone_parts = parts[0].split('-') # breaks up the digit string and removes the '-'
area_code = phone_parts[0]
The portion found after the the optional '&Ns=' can be checked to see if it is numeric with the string method isdigit, which will return true if all characters in the string are digits and there is at least one character, false otherwise.
if len(parts) > 1:
extra_digits_ok = parts[1].isdigit()