Python: How to replace N random string occurrences in text? - python

Say that I have 10 different tokens, "(TOKEN)" in a string. How do I replace 2 of those tokens, chosen at random, with some other string, leaving the other tokens intact?

>>> import random
>>> text = '(TOKEN)__(TOKEN)__(TOKEN)__(TOKEN)__(TOKEN)__(TOKEN)__(TOKEN)__(TOKEN)__(TOKEN)__(TOKEN)'
>>> token = '(TOKEN)'
>>> replace = 'foo'
>>> num_replacements = 2
>>> num_tokens = text.count(token) #10 in this case
>>> points = [0] + sorted(random.sample(range(1,num_tokens+1),num_replacements)) + [num_tokens+1]
>>> replace.join(token.join(text.split(token)[i:j]) for i,j in zip(points,points[1:]))
'(TOKEN)__(TOKEN)__(TOKEN)__(TOKEN)__foo__(TOKEN)__foo__(TOKEN)__(TOKEN)__(TOKEN)'
In function form:
>>> def random_replace(text, token, replace, num_replacements):
num_tokens = text.count(token)
points = [0] + sorted(random.sample(range(1,num_tokens+1),num_replacements)) + [num_tokens+1]
return replace.join(token.join(text.split(token)[i:j]) for i,j in zip(points,points[1:]))
>>> random_replace('....(TOKEN)....(TOKEN)....(TOKEN)....(TOKEN)....(TOKEN)....(TOKEN)....(TOKEN)....(TOKEN)....','(TOKEN)','FOO',2)
'....FOO....(TOKEN)....(TOKEN)....(TOKEN)....(TOKEN)....(TOKEN)....(TOKEN)....FOO....'
Test:
>>> for i in range(0,9):
print random_replace('....(0)....(0)....(0)....(0)....(0)....(0)....(0)....(0)....','(0)','(%d)'%i,i)
....(0)....(0)....(0)....(0)....(0)....(0)....(0)....(0)....
....(0)....(0)....(0)....(0)....(1)....(0)....(0)....(0)....
....(0)....(0)....(0)....(0)....(0)....(2)....(2)....(0)....
....(3)....(0)....(0)....(3)....(0)....(3)....(0)....(0)....
....(4)....(4)....(0)....(0)....(4)....(4)....(0)....(0)....
....(0)....(5)....(5)....(5)....(5)....(0)....(0)....(5)....
....(6)....(6)....(6)....(0)....(6)....(0)....(6)....(6)....
....(7)....(7)....(7)....(7)....(7)....(7)....(0)....(7)....
....(8)....(8)....(8)....(8)....(8)....(8)....(8)....(8)....

If you need exactly two, then:
Detect the tokens (keep some links to them, like index into the string)
Choose two at random (random.choice)
Replace them

What are you trying to do, exactly? A good answer will depend on that...
That said, a brute-force solution that comes to mind is to:
Store the 10 tokens in an array, such that tokens[0] is the first token, tokens[1] is the second, ... and so on
Create a dictionary to associate each unique "(TOKEN)" with two numbers: start_idx, end_idx
Write a little parser that walks through your string and looks for each of the 10 tokens. Whenever one is found, record the start/end indexes (as start_idx, end_idx) in the string where that token occurs.
Once done parsing, generate a random number in the range [0,9]. Lets call this R
Now, your random "(TOKEN)" is tokens[R];
Use the dictionary in step (3) to find the start_idx, end_idx values in the string; replace the text there with "some other string"

My solution in code:
import random
s = "(TOKEN)test(TOKEN)fgsfds(TOKEN)qwerty(TOKEN)42(TOKEN)(TOKEN)ttt"
replace_from = "(TOKEN)"
replace_to = "[REPLACED]"
amount_to_replace = 2
def random_replace(s, replace_from, replace_to, amount_to_replace):
parts = s.split(replace_from)
indices = random.sample(xrange(len(parts) - 1), amount_to_replace)
replaced_s_parts = list()
for i in xrange(len(parts)):
replaced_s_parts.append(parts[i])
if i < len(parts) - 1:
if i in indices:
replaced_s_parts.append(replace_to)
else:
replaced_s_parts.append(replace_from)
return "".join(replaced_s_parts)
#TEST
for i in xrange(5):
print random_replace(s, replace_from, replace_to, 2)
Explanation:
Splits string into several parts using replace_from
Chooses indexes of tokens to replace using random.sample. This returned list contains unique numbers
Build a list for string reconstruction, replacing tokens with generated index by replace_to.
Concatenate all list elements into single string

Try this solution:
import random
def replace_random(tokens, eqv, n):
random_tokens = eqv.keys()
random.shuffle(random_tokens)
for i in xrange(n):
t = random_tokens[i]
tokens = tokens.replace(t, eqv[t])
return tokens
Assuming that a string with tokens exists, and a suitable equivalence table can be constructed with a replacement for each token:
tokens = '(TOKEN1) (TOKEN2) (TOKEN3) (TOKEN4) (TOKEN5) (TOKEN6) (TOKEN7) (TOKEN8) (TOKEN9) (TOKEN10)'
equivalences = {
'(TOKEN1)' : 'REPLACEMENT1',
'(TOKEN2)' : 'REPLACEMENT2',
'(TOKEN3)' : 'REPLACEMENT3',
'(TOKEN4)' : 'REPLACEMENT4',
'(TOKEN5)' : 'REPLACEMENT5',
'(TOKEN6)' : 'REPLACEMENT6',
'(TOKEN7)' : 'REPLACEMENT7',
'(TOKEN8)' : 'REPLACEMENT8',
'(TOKEN9)' : 'REPLACEMENT9',
'(TOKEN10)' : 'REPLACEMENT10'
}
You can call it like this:
replace_random(tokens, equivalences, 2)
> '(TOKEN1) REPLACEMENT2 (TOKEN3) (TOKEN4) (TOKEN5) (TOKEN6) (TOKEN7) (TOKEN8) REPLACEMENT9 (TOKEN10)'

There are lots of ways to do this. My approach would be to write a function that takes the original string, the token string, and a function that returns the replacement text for an occurrence of the token in the original:
def strByReplacingTokensUsingFunction(original, token, function):
outputComponents = []
matchNumber = 0
unexaminedOffset = 0
while True:
matchOffset = original.find(token, unexaminedOffset)
if matchOffset < 0:
matchOffset = len(original)
outputComponents.append(original[unexaminedOffset:matchOffset])
if matchOffset == len(original):
break
unexaminedOffset = matchOffset + len(token)
replacement = function(original=original, offset=matchOffset, matchNumber=matchNumber, token=token)
outputComponents.append(replacement)
matchNumber += 1
return ''.join(outputComponents)
(You could certainly change this to use shorter identifiers. My style is somewhat more verbose than typical Python style.)
Given that function, it's easy to replace two random occurrences out of ten. Here's some sample input:
sampleInput = 'a(TOKEN)b(TOKEN)c(TOKEN)d(TOKEN)e(TOKEN)f(TOKEN)g(TOKEN)h(TOKEN)i(TOKEN)j(TOKEN)k'
The random module has a handy method for picking random items from a population (not picking the same item twice):
import random
replacementIndexes = random.sample(range(10), 2)
Then we can use the function above to replace the randomly-chosen occurrences:
sampleOutput = strByReplacingTokensUsingFunction(sampleInput, '(TOKEN)',
(lambda matchNumber, token, **keywords:
'REPLACEMENT' if (matchNumber in replacementIndexes) else token))
print sampleOutput
And here's some test output:
a(TOKEN)b(TOKEN)cREPLACEMENTd(TOKEN)e(TOKEN)fREPLACEMENTg(TOKEN)h(TOKEN)i(TOKEN)j(TOKEN)k
Here's another run:
a(TOKEN)bREPLACEMENTc(TOKEN)d(TOKEN)e(TOKEN)f(TOKEN)gREPLACEMENTh(TOKEN)i(TOKEN)j(TOKEN)k

from random import sample
mystr = 'adad(TOKEN)hgfh(TOKEN)hjgjh(TOKEN)kjhk(TOKEN)jkhjk(TOKEN)utuy(TOKEN)tyuu(TOKEN)tyuy(TOKEN)tyuy(TOKEN)tyuy(TOKEN)'
def replace(mystr, substr, n_repl, replacement='XXXXXXX', tokens=10, index=0):
choices = sorted(sample(xrange(tokens),n_repl))
for i in xrange(choices[-1]+1):
index = mystr.index(substr, index) + 1
if i in choices:
mystr = mystr[:index-1] + mystr[index-1:].replace(substr,replacement,1)
return mystr
print replace(mystr,'(TOKEN)',2)

Related

Find most common substring in a list of strings?

I have a Python list of string names where I would like to remove a common substring from all of the names.
And after reading this similar answer I could almost achieve the desired result using SequenceMatcher.
But only when all items have a common substring:
From List:
string 1 = myKey_apples
string 2 = myKey_appleses
string 3 = myKey_oranges
common substring = "myKey_"
To List:
string 1 = apples
string 2 = appleses
string 3 = oranges
However I have a slightly noisy list that contains a few scattered items that don't fit the same naming convention.
I would like to remove the "most common" substring from the majority:
From List:
string 1 = myKey_apples
string 2 = myKey_appleses
string 3 = myKey_oranges
string 4 = foo
string 5 = myKey_Banannas
common substring = ""
To List:
string 1 = apples
string 2 = appleses
string 3 = oranges
string 4 = foo
string 5 = Banannas
I need a way to match the "myKey_" substring so I can remove it from all names.
But when I use the SequenceMatcher the item "foo" causes the "longest match" to be equal to blank "".
I think the only way to solve this is to find the "most common substring". But how could that be accomplished?
Basic example code:
from difflib import SequenceMatcher
names = ["myKey_apples",
"myKey_appleses",
"myKey_oranges",
#"foo",
"myKey_Banannas"]
string2 = names[0]
for i in range(1, len(names)):
string1 = string2
string2 = names[i]
match = SequenceMatcher(None, string1, string2).find_longest_match(0, len(string1), 0, len(string2))
print(string1[match.a: match.a + match.size]) # -> myKey_
Given names = ["myKey_apples", "myKey_appleses", "myKey_oranges", "foo", "myKey_Banannas"]
An O(n^2) solution I can think of is to find all possible substrings and storing them in a dictionary with the number of times they occur :
substring_counts={}
for i in range(0, len(names)):
for j in range(i+1,len(names)):
string1 = names[i]
string2 = names[j]
match = SequenceMatcher(None, string1, string2).find_longest_match(0, len(string1), 0, len(string2))
matching_substring=string1[match.a:match.a+match.size]
if(matching_substring not in substring_counts):
substring_counts[matching_substring]=1
else:
substring_counts[matching_substring]+=1
print(substring_counts) #{'myKey_': 5, 'myKey_apples': 1, 'o': 1, '': 3}
And then picking the maximum occurring substring
import operator
max_occurring_substring=max(substring_counts.iteritems(), key=operator.itemgetter(1))[0]
print(max_occurring_substring) #myKey_
Here's a overly verbose solution to your problem:
def find_matching_key(list_in, max_key_only = True):
"""
returns the longest matching key in the list * with the highest frequency
"""
keys = {}
curr_key = ''
# If n does not exceed max_n, don't bother adding
max_n = 0
for word in list(set(list_in)): #get unique values to speed up
for i in range(len(word)):
# Look up the whole word, then one less letter, sequentially
curr_key = word[0:len(word)-i]
# if not in, count occurance
if curr_key not in keys.keys() and curr_key!='':
n = 0
for word2 in list_in:
if curr_key in word2:
n+=1
# if large n, Add to dictionary
if n > max_n:
max_n = n
keys[curr_key] = n
# Finish the word
# Finish for loop
if max_key_only:
return max(keys, key=keys.get)
else:
return keys
# Create your "from list"
From_List = [
"myKey_apples",
"myKey_appleses",
"myKey_oranges",
"foo",
"myKey_Banannas"
]
# Use the function
key = find_matching_key(From_List, True)
# Iterate over your list, replacing values
new_From_List = [x.replace(key,'') for x in From_List]
print(new_From_List)
['apples', 'appleses', 'oranges', 'foo', 'Banannas']
Needless to say, this solution would look a lot neater with recursion. Thought I'd sketch out a rough dynamic programming solution for you though.
I would first find the starting letter with the most occurrences. Then I would take each word having that starting letter, and take while all these words have matching letters. Then in the end I would remove the prefix that was found from each starting word:
from collections import Counter
from itertools import takewhile
strings = ["myKey_apples", "myKey_appleses", "myKey_oranges", "berries"]
def remove_mc_prefix(words):
cnt = Counter()
for word in words:
cnt[word[0]] += 1
first_letter = list(cnt)[0]
filter_list = [word for word in words if word[0] == first_letter]
filter_list.sort(key = lambda s: len(s)) # To avoid iob
prefix = ""
length = len(filter_list[0])
for i in range(length):
test = filter_list[0][i]
if all([word[i] == test for word in filter_list]):
prefix += test
else: break
return [word[len(prefix):] if word.startswith(prefix) else word for word in words]
print(remove_mc_prefix(strings))
Out: ['apples', 'appleses', 'oranges', 'berries']
To find the most-common-substring from list of python-string
I already tested on python-3.10.5 I hope it will work for you.
I have the same use case but a different kind of task, I just need to find one common-pattern-string from a list of more than 100s files. To use as a regular-expression.
Your Basic example code is not working in my case. because 1st checking with 2nd, 2nd with 3rd, 3rd with 4th and so on. So, I change it to the most common substring and will check with each one.
The downside of this code is that if something is not common with the most common substring, the final most common substring will be an empty one.
But in my case, it is working.
from difflib import SequenceMatcher
for i in range(1, len(names)):
if i==1:
string1, string2 = names[0], names[i]
else:
string1, string2 = most_common_substring, names[i]
match = SequenceMatcher(None, string1, string2).find_longest_match(0, len(string1), 0, len(string2))
most_common_substring = string1[match.a: match.a + match.size]
print(f"most_common_substring : {most_common_substring}")
python python-3python-difflib

Cut string within a specific pattern in python

I have string of some length consisting of only 4 characters which are 'A,T,G and C'. I have pattern 'GAATTC' present multiple times in the given string. I have to cut the string at intervals where this pattern is..
For example for a string, 'ATCGAATTCATA', I should get output of
string one - ATCGA
string two - ATTCATA
I am newbie in using Python but I have come up with the following (incomplete) code:
seq = seq.upper()
str1 = "GAATTC"
seqlen = len(seq)
seq = list(seq)
for i in range(0,seqlen-1):
site = seq.find(str1)
print(site[0:(i+2)])
Any help would be really appreciated.
First lets develop your idea of using find, so you can figure out your mistakes.
seq = 'ATCGAATTCATAATCGAATTCATAATCGAATTCATA'
seq = seq.upper()
pattern = "GAATTC"
split_at = 2
seqlen = len(seq)
i = 0
while i < seqlen:
site = seq.find(pattern, i)
if site != -1:
print(seq[i: site + split_at])
i = site + split_at
else:
print seq[i:]
break
Yet python string sports a powerful replace method that directly replaces fragments of string. The below snippet uses the replace method to insert separators when needed:
seq = 'ATCGAATTCATAATCGAATTCATAATCGAATTCATA'
seq = seq.upper()
pattern = "GA","ATTC"
pattern1 = ''.join(pattern) # 'GAATTC'
pattern2 = ' '.join(pattern) # 'GA ATTC'
splited_seq = seq.replace(pattern1, pattern2) # 'ATCGA ATTCATAATCGA ATTCATAATCGA ATTCATA'
print (splited_seq.split())
I believe it is more intuitive and should be faster then RE (which might have lower performance, depending on library and usage)
Here is a simple solution :
seq = 'ATCGAATTCATA'
seq_split = seq.upper().split('GAATTC')
result = [
(seq_split[i] + 'GA') if i % 2 == 0 else ('ATTC' + seq_split[i])
for i in range(len(seq_split)) if len(seq_split[i]) > 0
]
Result :
print(result)
['ATCGA', 'ATTCATA']
BioPython has a restriction enzyme package to do exactly what you're asking.
from Bio.Restriction import *
from Bio.Alphabet.IUPAC import IUPACAmbiguousDNA
print(EcoRI.site) # You will see that this is the enzyme you listed above
test = 'ATCGAATTCATA'.upper() # This is the sequence you want to search
my_seq = Seq(test, IUPACAmbiguousDNA()) # Create a biopython Seq object with our sequence
cut_sites = EcoRI.search(my_seq)
cut_sites contain a list of exactly where to cut the input sequence (such that GA is in the left sequence and ATTC is in the right sequence.
You can then split the sequence into contigs using:
cut_sites = [0] + cut_sites # We add a leading zero so this works for the first
# contig. This might not always be needed.
contigs = [test[i:j] for i,j in zip(cut_sites, cut_sites[1:]+[None])]
You can see this page for more details about BioPython.
My code is a bit sloppy, but you could try something like this when you want to iterate over multiple occurrences of the string
def split_strings(seq):
string1 = seq[:seq.find(str1) +2]
string2 = seq[seq.find(str1) +2:]
return string1, string2
test = 'ATCGAATTCATA'.upper()
str1 = 'GAATTC'
seq = test
while str1 in seq:
string1, seq = split_strings(seq)
print string1
print seq
Here's a solution using the regular expression module:
import re
seq = 'ATCGAATTCATA'
restriction_site = re.compile('GAATTC')
subseq_start = 0
for match in restriction_site.finditer(seq):
print seq[subseq_start:match.start()+2]
subseq_start = match.start()+2
print seq[subseq_start:]
Output:
ATCGA
ATTCATA

Python replace 3 random characters in a string with no duplicates

I need change 3 random characters in a string using Python, example string:
Adriano Celentano
Luca Valentina
I need to replace 3 characters, not replacing with the same character or number, not replacing space. How can I do this using Python ?
Need output like this :
adraano cettntano
lacr vilenntina
I don't know from where i can start to make this.
My code so far:
for i in xrange(4):
for n in nume :
print n.replace('$', random.choice(string.letters)).replace('#', random.choice(string.letters))
If you just want to change chars that are not whitespace and not the same char in regards to index, you can first pull the indexes where the non-whitespace chars are:
import random
inds = [i for i,_ in enumerate(s) if not s.isspace()]
print(random.sample(inds,3))
Then use those indexes to replace.
s = "Adriano Celentano"
import random
inds = [i for i,_ in enumerate(s) if not s.isspace()]
sam = random.sample(inds, 3)
from string import ascii_letters
lst = list(s)
for ind in sam:
lst[ind] = random.choice(ascii_letters)
print("".join(lst))
If you want a unique char each time to replace with also:
s = "Adriano Celentano"
import random
from string import ascii_letters
inds = [i for i,_ in enumerate(s) if not s.isspace()]
sam = random.sample(inds, 3)
letts = iter(random.sample(ascii_letters, 3))
lst = list(s)
for ind in sam:
lst[ind] = next(letts)
print("".join(lst))
output:
Adoiano lelenhano
You can do this in two stages. In the first stage you pick 3 random positions in your string that meet your search criteria (isalnum):
import random
import string
replacement_chars='abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789'
# replacement_chars = string.letters + string.digits
input = 'Adriano Celentano'
input_list = list(input)
input_dic = dict(enumerate(input_list))
valid_positions=[key for key in input_dic if input_dic[key].isalnum()]
random_positions=random.sample(valid_positions,3)
In the second part you generate 3 random characters and replace the characters in the previously selected positions. I have added a while loop to generate a new random character if it matches the existing value
random_chars = random.sample(replacement_chars,len(random_positions))
char_counter = 0
for position in random_positions:
#check if the replacement character matches the existing one
#and generate another one if needed
while input_list[position]==random_chars[char_counter]:
random_chars[char_counter] = random.choice(replacement_chars)
input_list[position]=random_chars[char_counter]
char_counter = char_counter + 1
print "".join(input_list).lower()

How to compress a python list of strings in format string[number]/[number]

I have a list of strings ending with numbers. Want to sort them in python and then compress them if a range is formed.
Eg input string :
ABC1/3, ABC1/1, ABC1/2, ABC2/3, ABC2/2, ABC2/1
Eg output string:
ABC1/1-3, ABC2/1-3
How should I approach this problem with python?
There's no need to use a dict for this problem. You can simply parse the tokens into a list and sort it. By default Python sorts a list of lists by the individual elements of each list. After sorting the list of token pairs, you only need to iterate once and record the important indices. Try this:
# Data is a comma separated list of name/number pairs.
data = 'ABC1/3, ABC1/1, ABC1/2, ABC2/3, ABC2/2, ABC2/1'
# Split data on ', ' and split each token on '/'.
tokens = [token.split('/') for token in data.split(', ')]
# Convert token number to integer.
for index in range(len(tokens)):
tokens[index][1] = int(tokens[index][1])
# Sort pairs, automatically orders lists by items.
tokens.sort()
prev = 0 # Record index of previous pair's name.
indices = [] # List to record indices for output.
for index in range(1, len(tokens)):
# If name matches with previous position.
if tokens[index][0] == tokens[prev][0]:
# Check whether number is increasing sequentially.
if tokens[index][1] != (tokens[index - 1][1] + 1):
# If non-sequential increase then record the indices.
indices.append((prev, index - 1))
prev = index
else:
# If name changes then record the indices.
indices.append((prev, index - 1))
prev = index
# After iterating the list, record the indices.
indices.append((prev, index))
# Print the ranges.
for start, end in indices:
if start == end:
args = (tokens[start][0], tokens[start][1])
print '{0}/{1},'.format(*args),
else:
args = (tokens[start][0], tokens[start][1], tokens[end][1])
print '{0}/{1}-{2},'.format(*args),
# Output:
# ABC1/1-3 ABC2/1-3
I wanted to speedhack this problem, so here is an almost complete solution for you, based on my own make_range_string and a stolen natsort.
import re
from collections import defaultdict
def sortkey_natural(s):
return tuple(int(part) if re.match(r'[0-9]+$', part) else part
for part in re.split(r'([0-9]+)', s))
def natsort(collection):
return sorted(collection, key=sortkey_natural)
def make_range_string(collection):
collection = sorted(collection)
parts = []
range_start = None
previous = None
def push_range(range_start, previous):
if range_start is not None:
if previous == range_start:
parts.append(str(previous))
else:
parts.append("{}-{}".format(range_start, previous))
for i in collection:
if previous != i - 1:
push_range(range_start, previous)
range_start = i
previous = i
push_range(range_start, previous)
return ', '.join(parts)
def make_ranges(strings):
components = defaultdict(list)
for i in strings:
main, _, number = i.partition('/')
components[main].append(int(number))
rvlist = []
for key in natsort(components):
rvlist.append((key, make_range_string(components[key])))
return rvlist
print(make_ranges(['ABC1/3', 'ABC1/1', 'ABC1/2', 'ABC2/5', 'ABC2/2', 'ABC2/1']))
The code prints a list of tuples:
[('ABC1', '1-3'), ('ABC2', '1-2, 5')]
I would start by splitting the strings, and using the part that you want to match on as a dictionary key.
strings = ['ABC1/3', 'ABC1/1', 'ABC1/2', 'ABC2/3', 'ABC2/2', 'ABC2/1']
d = {}
for s in string:
a, b = s.split('/')
d.get(a, default=[]).append(b)
That collects the number parts into a list for each prefix. Then you can sort the lists and look for adjacent numbers to join.

How to find all occurrences of a substring?

Python has string.find() and string.rfind() to get the index of a substring in a string.
I'm wondering whether there is something like string.find_all() which can return all found indexes (not only the first from the beginning or the first from the end).
For example:
string = "test test test test"
print string.find('test') # 0
print string.rfind('test') # 15
#this is the goal
print string.find_all('test') # [0,5,10,15]
For counting the occurrences, see Count number of occurrences of a substring in a string.
There is no simple built-in string function that does what you're looking for, but you could use the more powerful regular expressions:
import re
[m.start() for m in re.finditer('test', 'test test test test')]
#[0, 5, 10, 15]
If you want to find overlapping matches, lookahead will do that:
[m.start() for m in re.finditer('(?=tt)', 'ttt')]
#[0, 1]
If you want a reverse find-all without overlaps, you can combine positive and negative lookahead into an expression like this:
search = 'tt'
[m.start() for m in re.finditer('(?=%s)(?!.{1,%d}%s)' % (search, len(search)-1, search), 'ttt')]
#[1]
re.finditer returns a generator, so you could change the [] in the above to () to get a generator instead of a list which will be more efficient if you're only iterating through the results once.
>>> help(str.find)
Help on method_descriptor:
find(...)
S.find(sub [,start [,end]]) -> int
Thus, we can build it ourselves:
def find_all(a_str, sub):
start = 0
while True:
start = a_str.find(sub, start)
if start == -1: return
yield start
start += len(sub) # use start += 1 to find overlapping matches
list(find_all('spam spam spam spam', 'spam')) # [0, 5, 10, 15]
No temporary strings or regexes required.
Here's a (very inefficient) way to get all (i.e. even overlapping) matches:
>>> string = "test test test test"
>>> [i for i in range(len(string)) if string.startswith('test', i)]
[0, 5, 10, 15]
Use re.finditer:
import re
sentence = input("Give me a sentence ")
word = input("What word would you like to find ")
for match in re.finditer(word, sentence):
print (match.start(), match.end())
For word = "this" and sentence = "this is a sentence this this" this will yield the output:
(0, 4)
(19, 23)
(24, 28)
Again, old thread, but here's my solution using a generator and plain str.find.
def findall(p, s):
'''Yields all the positions of
the pattern p in the string s.'''
i = s.find(p)
while i != -1:
yield i
i = s.find(p, i+1)
Example
x = 'banananassantana'
[(i, x[i:i+2]) for i in findall('na', x)]
returns
[(2, 'na'), (4, 'na'), (6, 'na'), (14, 'na')]
You can use re.finditer() for non-overlapping matches.
>>> import re
>>> aString = 'this is a string where the substring "is" is repeated several times'
>>> print [(a.start(), a.end()) for a in list(re.finditer('is', aString))]
[(2, 4), (5, 7), (38, 40), (42, 44)]
but won't work for:
In [1]: aString="ababa"
In [2]: print [(a.start(), a.end()) for a in list(re.finditer('aba', aString))]
Output: [(0, 3)]
Come, let us recurse together.
def locations_of_substring(string, substring):
"""Return a list of locations of a substring."""
substring_length = len(substring)
def recurse(locations_found, start):
location = string.find(substring, start)
if location != -1:
return recurse(locations_found + [location], location+substring_length)
else:
return locations_found
return recurse([], 0)
print(locations_of_substring('this is a test for finding this and this', 'this'))
# prints [0, 27, 36]
No need for regular expressions this way.
If you're just looking for a single character, this would work:
string = "dooobiedoobiedoobie"
match = 'o'
reduce(lambda count, char: count + 1 if char == match else count, string, 0)
# produces 7
Also,
string = "test test test test"
match = "test"
len(string.split(match)) - 1
# produces 4
My hunch is that neither of these (especially #2) is terribly performant.
this is an old thread but i got interested and wanted to share my solution.
def find_all(a_string, sub):
result = []
k = 0
while k < len(a_string):
k = a_string.find(sub, k)
if k == -1:
return result
else:
result.append(k)
k += 1 #change to k += len(sub) to not search overlapping results
return result
It should return a list of positions where the substring was found.
Please comment if you see an error or room for improvment.
This does the trick for me using re.finditer
import re
text = 'This is sample text to test if this pythonic '\
'program can serve as an indexing platform for '\
'finding words in a paragraph. It can give '\
'values as to where the word is located with the '\
'different examples as stated'
# find all occurances of the word 'as' in the above text
find_the_word = re.finditer('as', text)
for match in find_the_word:
print('start {}, end {}, search string \'{}\''.
format(match.start(), match.end(), match.group()))
This thread is a little old but this worked for me:
numberString = "onetwothreefourfivesixseveneightninefiveten"
testString = "five"
marker = 0
while marker < len(numberString):
try:
print(numberString.index("five",marker))
marker = numberString.index("five", marker) + 1
except ValueError:
print("String not found")
marker = len(numberString)
You can try :
>>> string = "test test test test"
>>> for index,value in enumerate(string):
if string[index:index+(len("test"))] == "test":
print index
0
5
10
15
You can try :
import re
str1 = "This dress looks good; you have good taste in clothes."
substr = "good"
result = [_.start() for _ in re.finditer(substr, str1)]
# result = [17, 32]
When looking for a large amount of key words in a document, use flashtext
from flashtext import KeywordProcessor
words = ['test', 'exam', 'quiz']
txt = 'this is a test'
kwp = KeywordProcessor()
kwp.add_keywords_from_list(words)
result = kwp.extract_keywords(txt, span_info=True)
Flashtext runs faster than regex on large list of search words.
This function does not look at all positions inside the string, it does not waste compute resources. My try:
def findAll(string,word):
all_positions=[]
next_pos=-1
while True:
next_pos=string.find(word,next_pos+1)
if(next_pos<0):
break
all_positions.append(next_pos)
return all_positions
to use it call it like this:
result=findAll('this word is a big word man how many words are there?','word')
src = input() # we will find substring in this string
sub = input() # substring
res = []
pos = src.find(sub)
while pos != -1:
res.append(pos)
pos = src.find(sub, pos + 1)
Whatever the solutions provided by others are completely based on the available method find() or any available methods.
What is the core basic algorithm to find all the occurrences of a
substring in a string?
def find_all(string,substring):
"""
Function: Returning all the index of substring in a string
Arguments: String and the search string
Return:Returning a list
"""
length = len(substring)
c=0
indexes = []
while c < len(string):
if string[c:c+length] == substring:
indexes.append(c)
c=c+1
return indexes
You can also inherit str class to new class and can use this function
below.
class newstr(str):
def find_all(string,substring):
"""
Function: Returning all the index of substring in a string
Arguments: String and the search string
Return:Returning a list
"""
length = len(substring)
c=0
indexes = []
while c < len(string):
if string[c:c+length] == substring:
indexes.append(c)
c=c+1
return indexes
Calling the method
newstr.find_all('Do you find this answer helpful? then upvote
this!','this')
This is solution of a similar question from hackerrank. I hope this could help you.
import re
a = input()
b = input()
if b not in a:
print((-1,-1))
else:
#create two list as
start_indc = [m.start() for m in re.finditer('(?=' + b + ')', a)]
for i in range(len(start_indc)):
print((start_indc[i], start_indc[i]+len(b)-1))
Output:
aaadaa
aa
(0, 1)
(1, 2)
(4, 5)
Here's a solution that I came up with, using assignment expression (new feature since Python 3.8):
string = "test test test test"
phrase = "test"
start = -1
result = [(start := string.find(phrase, start + 1)) for _ in range(string.count(phrase))]
Output:
[0, 5, 10, 15]
I think the most clean way of solution is without libraries and yields:
def find_all_occurrences(string, sub):
index_of_occurrences = []
current_index = 0
while True:
current_index = string.find(sub, current_index)
if current_index == -1:
return index_of_occurrences
else:
index_of_occurrences.append(current_index)
current_index += len(sub)
find_all_occurrences(string, substr)
Note: find() method returns -1 when it can't find anything
The pythonic way would be:
mystring = 'Hello World, this should work!'
find_all = lambda c,s: [x for x in range(c.find(s), len(c)) if c[x] == s]
# s represents the search string
# c represents the character string
find_all(mystring,'o') # will return all positions of 'o'
[4, 7, 20, 26]
>>>
if you only want to use numpy here is a solution
import numpy as np
S= "test test test test"
S2 = 'test'
inds = np.cumsum([len(k)+len(S2) for k in S.split(S2)[:-1]])- len(S2)
print(inds)
if you want to use without re(regex) then:
find_all = lambda _str,_w : [ i for i in range(len(_str)) if _str.startswith(_w,i) ]
string = "test test test test"
print( find_all(string, 'test') ) # >>> [0, 5, 10, 15]
please look at below code
#!/usr/bin/env python
# coding:utf-8
'''黄哥Python'''
def get_substring_indices(text, s):
result = [i for i in range(len(text)) if text.startswith(s, i)]
return result
if __name__ == '__main__':
text = "How much wood would a wood chuck chuck if a wood chuck could chuck wood?"
s = 'wood'
print get_substring_indices(text, s)
def find_index(string, let):
enumerated = [place for place, letter in enumerate(string) if letter == let]
return enumerated
for example :
find_index("hey doode find d", "d")
returns:
[4, 7, 13, 15]
Not exactly what OP asked but you could also use the split function to get a list of where all the substrings don't occur. OP didn't specify the end goal of the code but if your goal is to remove the substrings anyways then this could be a simple one-liner. There are probably more efficient ways to do this with larger strings; regular expressions would be preferable in that case
# Extract all non-substrings
s = "an-example-string"
s_no_dash = s.split('-')
# >>> s_no_dash
# ['an', 'example', 'string']
# Or extract and join them into a sentence
s_no_dash2 = ' '.join(s.split('-'))
# >>> s_no_dash2
# 'an example string'
Did a brief skim of other answers so apologies if this is already up there.
def count_substring(string, sub_string):
c=0
for i in range(0,len(string)-2):
if string[i:i+len(sub_string)] == sub_string:
c+=1
return c
if __name__ == '__main__':
string = input().strip()
sub_string = input().strip()
count = count_substring(string, sub_string)
print(count)
I runned in the same problem and did this:
hw = 'Hello oh World!'
list_hw = list(hw)
o_in_hw = []
while True:
o = hw.find('o')
if o != -1:
o_in_hw.append(o)
list_hw[o] = ' '
hw = ''.join(list_hw)
else:
print(o_in_hw)
break
Im pretty new at coding so you can probably simplify it (and if planned to used continuously of course make it a function).
All and all it works as intended for what i was doing.
Edit: Please consider this is for single characters only, and it will change your variable, so you have to create a copy of the string in a new variable to save it, i didnt put it in the code cause its easy and its only to show how i made it work.
By slicing we find all the combinations possible and append them in a list and find the number of times it occurs using count function
s=input()
n=len(s)
l=[]
f=input()
print(s[0])
for i in range(0,n):
for j in range(1,n+1):
l.append(s[i:j])
if f in l:
print(l.count(f))
To find all the occurence of a character in a give string and return as a dictionary
eg: hello
result :
{'h':1, 'e':1, 'l':2, 'o':1}
def count(string):
result = {}
if(string):
for i in string:
result[i] = string.count(i)
return result
return {}
or else you do like this
from collections import Counter
def count(string):
return Counter(string)

Categories