We Keep Coding

Python read n line of a file with zipfile.ZipFile

I would like to know if it's possible to read the second line of each files contains in a zip file?
zf = zipfile.ZipFile(myzip.zip)
for f in zf.namelist():
csv_f = zf.read(f)
first_line = csv_f.split('\n', 2)[0] ...?
thanks for any help.

Yes. Like this:
with zipfile.ZipFile("myzip.zip") as z:
for n in z.namelist():
with z.open(n) as f:
for i in range(2):
second_line = next(f)
This will only read the first two lines without reading the whole file, based on the recommendation by #S3DEV. One could be more fancy about not writing the first line to a variable second_line, but since it is overwritten on the second pass, this doesn't seem to clever.

read keyword in txt file, and print add text + keyword

I got many keywords in txt file to python using f = open().
And I want to add text before each keywords.
example,
(http://www.google.com/) + (abcdefg)
add text keywords imported
It have tried it, I can't result I want.
f = open("C:/abc/abc.txt", 'r')
data = f.read()
print("http://www.google.com/" + data)
f.close()
I tried it using "for".
But, I can't it.
Please let me know the solution.
many thanks.

Your original code has some flaws:
you only read the first line of the file, with data = f.read(). If you want to read all the lines from the file, use a for;
data is a str-type variable, which may have more than one word. Thus, you must split this line into words, using data.split()
To solve your problem, you need to read each line from the file, split the line into the words it has, then loop through the list with the words, add the desired text then the word itself.
The correct program is this:
f = open("C:/abc/abc.txt", 'r')
for data in f:
words = data.split()
for i in words:
print("http://www.google.com/" + i)
f.close()

with open('text.txt','r') as f:
for line in f:
print("http://www.google.com/" + line)

Find unique entries in files

guess you have a solution concerning the following issue:
I want to compare two lists for common entries (on the basis of column 10) and write common entries to one file and unique entries for the first list into another file. The code I wrote is:
INFILE1 = open ("c:\\python\\test\\58962.filtered.csv", "r")
INFILE2 = open ("c:\\python\\test\\83887.filtered.csv", "r")
OUTFILE1 = open ("c:\\python\\test\\58962_vs_83887.common.csv", "w")
OUTFILE2 = open ("c:\\python\\test\\58962_vs_83887.unique.csv", "w")
for line in INFILE1:
line = line.rstrip().split(",")
if line[11] in INFILE2:
OUTFILE1.write(line)
else:
OUTFILE2.write(line)
INFILE1.close()
INFILE2.close()
OUTFILE1.close()
OUTFILE2.close()
The following error appears:
8 OUTFILE1.write(line)
9 else:
---> 10 OUTFILE2.write(line)
11 INFILE1.close()
TypeError: write() argument must be str, not list
Does somebody know about help for this?
Best

This line
line = line.rstrip().split(",")
replaces the line you read from a file by it's splitted list. You then try to write the splitted list to your file - thats not how the write method works and it tells you exactly that.
Change it to :
for line in INFILE1:
lineList = line.rstrip().split(",") # dont overwrite line, use lineList
if lineList[11] in INFILE2: # used lineList
OUTFILE1.write(line) # corrected indentation
else:
OUTFILE2.write(line)
You could have easily found your error yourself, just printing out the line before and after splitting or just befrore writing.
Please read How to debug small programs (#1) and follow it - its easier to find and fix bugs yourself then posting questions here.
You have some other problem at hand, though:
Files are stream based, they start with a position of 0 in the file. The position is advanced if you access parts of the file. When at the end, you wont get anything by using INFILE2.read() or other methods.
So if you want to repeatadly check if some lines column of file1 is somewhere in file2 you need to read file2 into a list (or other datastructure) so your repeated checks work. In other words, this:
if lineList[11] in INFILE2:
might work once, then the file is consumed and it will return false all the time.
You also might want to change from:
f = open(...., ...)
# do something with f
f.close()
to
with open(name,"r") as f:
# do something with f, no close needed, closed when leaving block
as it is safer, will close the file even if exceptions happen.
To solve that try this (untested) code:
with open ("c:\\python\\test\\83887.filtered.csv", "r") as file2:
infile2 = file2.readlines() # read in all lines as list
with open ("c:\\python\\test\\58962.filtered.csv", "r") as INFILE1:
# next 2 lines are 1 line, \ at end signifies line continues
with open ("c:\\python\\test\\58962_vs_83887.common.csv", "w") as OUTFILE1, \
with open ("c:\\python\\test\\58962_vs_83887.unique.csv", "w") as OUTFILE2:
for line in INFILE1:
lineList = line.rstrip().split(",")
if any(lineList[11] in x for x in infile2): # check the list of lines if
# any contains line[11]
OUTFILE1.write(line)
else:
OUTFILE2.write(line)
# all files are autoclosed here
Links to read:
the-with-statement
any() and other built-ins

filtering a weird text file in python

I have a text file in which each ID line starts with > and the next line(s) are the a sequence of characters. And the next line after the sequence of characters would be an other ID line starting with >. but in some of them, instead of sequence I have “Sequence unavailable”. The sequence after the ID line can be one or more lines.
like this example:
>ENSG00000173153|ENST00000000442|64073050;64074640|64073208;64074651
AAGCAGCCGGCGGCGCCGCCGAGTGAGGGGACGCGGCGCGGTGGGGCGGCGCGGCCCGAGGAGGCGGCGGAGGAGGGGCCGCCCGCGGCCCCCGGCTCACTCCGGCACTCCGGGCCGCTC
>ENSG00000004139|ENST00000003834
Sequence unavailable
I want to filter out those IDs with “Sequence unavailable”. The output should look like this:
output:
>ENSG00000173153|ENST00000000442|64073050;64074640|64073208;64074651
AAGCAGCCGGCGGCGCCGCCGAGTGAGGGGACGCGGCGCGGTGGGGCGGCGCGGCCCGAGGAGGCGGCGGAGGAGGGGCCGCCCGCGGCCCCCGGCTCACTCCGGCACTCCGGGCCGCTC
do you know how to do that in python?

Unlike the other answers, I’d strongly recommand against parsing the FASTA format manually. It’s not too hard but there are pitfalls, and it’s completely unnecessary since efficient, well-tested implementations exist:
Use Bio.SeqIO from BioPython; for example:
from Bio import SeqIO
for record in SeqIO.parse(filename, 'fasta'):
if record.seq != 'Sequenceunavailable':
SeqIO.write(record, outfile, 'fasta')
Note the missing space in 'Sequenceunavailable': reading the sequences in FASTA format will omit spaces.

How about this:
with open(filename, 'r+') as f:
data = f.read()
data = data.split('>')
result = ['>{}'.format(item) for item in data if item and 'Sequence unavailable' not in item]
f.seek(0)
for line in result:
f.write(line)

def main():
filename = open('text.txt', 'rU').readlines()
filterFile(filename)
def filterFile(SequenceFile):
outfile = open('outfile', 'w')
for line in SequenceFile:
if line.startswith('>'):
sequence = line.next()
if sequence.startswith('Sequence unavailable'):
//nothing should happen I suppose?
else:
outfile.write(line + "\n" + sequence + "\n")
main()
I unfortunately can't test this code right now but I made this out of the top of my head! Please test it and let me know what the outcome is so I can adjust the code :-)

So I don't exactly know how large these files will get, just in case, I'm doing it without mapping the file in memory:
with open(filename) as fh:
with open(filename+'.new', 'w+') as fh_new:
for idline, geneseq in zip(*[iter(fh)] * 2):
if geneseq.strip() != 'Sequence unavailable':
fh_new.write(idline)
fh_new.write(geneseq)
It works by creating a new file, then the zip thing is some magic to read the 2 lines of the file, the idline will be the first part and the geneseq the second part.
This solution should be relatively cheap in computer power but will create an extra output file.

Python- How to Remove Columns from a File

I'd like to remove the first column from a file. The file contains 3 columns separated by space and the columns has the following titles:
X', 'Displacement' and 'Force' (Please see the image).
I have came up with the following code, but to my disappointment it doesn't work!
f = open("datafile.txt", 'w')
for line in f:
line = line.split()
del x[0]
f.close()
Any help is much appreciated !
Esan

First of all, you're attempting to read from a file (by iterating through the file contents) that is open for writing. This will give you an IOError.
Second, there is no variable named x in existence (you have not declared/set one in the script). This will generate a NameError.
Thirdly and finally, once you have finished (correctly) reading and editing the columns in your file, you will need to write the data back into the file.
To avoid loading a (potentially large) file into memory all at once, it is probably a good idea to read from one file (line by line) and write to a new file simultaneously.
Something like this might work:
f = open("datafile.txt", "r")
g = open("datafile_fixed.txt", "w")
for line in f:
if line.strip():
g.write("\t".join(line.split()[1:]) + "\n")
f.close()
g.close()

Some reading about python i/o might be helpful, but something like the following should get you on your feet:
with open("datafile.txt", "r") as fin:
with open("outputfile.txt", "w") as fout:
for line in fin:
line = line.split(' ')
if len(line) == 3:
del line[0]
fout.write(line[0] + ' ' + line[1])
else:
fout.write('\n')
EDIT: fixed to work with blank lines

print ''.join([' '.join(l.split()[1:]) for l in file('datafile.txt')])
or, if you want to preserve spaces and you know that the second column always starts at the, say, 10th character:
print ''.join([l[11:] for l in file('datafile.txt')])