Hey there, I love regular expressions, but I'm just not good at them at all.
I have a list of some 400 shortened words such as lol, omg, lmao...etc. Whenever someone types one of these shortened words, it is replaced with its English counterpart ([laughter], or something to that effect). Anyway, people are annoying and type these short-hand words with the last letter(s) repeated x number of times.
examples:
omg -> omgggg, lol -> lollll, haha -> hahahaha, lol -> lololol
I was wondering if anyone could hand me the regex (in Python, preferably) to deal with this?
Thanks all.
(It's a Twitter-related project for topic identification if anyone's curious. If someone tweets "Let's go shoot some hoops", how do you know the tweet is about basketball, etc)
FIRST APPROACH -
Well, using regular expression(s) you could do like so -
import re
re.sub('g+', 'g', 'omgggg')
re.sub('l+', 'l', 'lollll')
etc.
Let me point out that using regular expressions is a very fragile & basic approach to dealing with this problem. You could so easily get strings from users which will break the above regular expressions. What I am trying to say is that this approach requires lot of maintenance in terms of observing the patterns of mistakes the users make & then creating case specific regular expressions for them.
SECOND APPROACH -
Instead have you considered using difflib module? It's a module with helpers for computing deltas between objects. Of particular importance here for you is SequenceMatcher. To paraphrase from official documentation-
SequenceMatcher is a flexible class
for comparing pairs of sequences of
any type, so long as the sequence
elements are hashable. SequenceMatcher
tries to compute a "human-friendly
diff" between two sequences. The
fundamental notion is the longest
contiguous & junk-free matching subsequence.
import difflib as dl
x = dl.SequenceMatcher(lambda x : x == ' ', "omg", "omgggg")
y = dl.SequenceMatcher(lambda x : x == ' ', "omgggg","omg")
avg = (x.ratio()+y.ratio())/2.0
if avg>= 0.6:
print 'Match!'
else:
print 'Sorry!'
According to documentation, any ratio() over 0.6 is a close match. You might need to explore tweak the ratio for your data needs. If you need more stricter matching I found any value over 0.8 serves well.
How about
\b(?=lol)\S*(\S+)(?<=\blol)\1*\b
(replace lol with omg, haha etc.)
This will match lol, lololol, lollll, lollollol etc. but fail lolo, lollllo, lolly and so on.
The rules:
Match the word lol completely.
Then allow any repetition of one or more characters at the end of the word (i. e. l, ol or lol)
So \b(?=zomg)\S*(\S+)(?<=\bzomg)\1*\b will match zomg, zomggg, zomgmgmg, zomgomgomg etc.
In Python, with comments:
result = re.sub(
r"""(?ix)\b # assert position at a word boundary
(?=lol) # assert that "lol" can be matched here
\S* # match any number of characters except whitespace
(\S+) # match at least one character (to be repeated later)
(?<=\blol) # until we have reached exactly the position after the 1st "lol"
\1* # then repeat the preceding character(s) any number of times
\b # and ensure that we end up at another word boundary""",
"lol", subject)
This will also match the "unadorned" version (i. e. lol without any repetition). If you don't want this, use \1+ instead of \1*.
Related
I have a list of keywords. A sample is:
['IO', 'IO Combination','CPI Combos']
Now what I am trying to do is see if any of these keywords is present in a string. For example, if my string is: there is a IO competition coming in Summer 2018. So for this example since it contains IO, it should identify that but if the string is there is a competition coming in Summer 2018 then it should not identify any keywords.
I wrote this Python code but it also identifies IO in competition:
if any(word.lower() in string_1.lower() for word in keyword_list):
print('FOUND A KEYWORD IN STRING')
I also want to identify which keyword was identified in the string (if any present). What is the issue in my code and how can I make sure that it matches only complete words?
Regex solution
You'll need to implement word boundaries here:
import re
keywords = ['IO', 'IO Combination','CPI Combos']
words_flat = "|".join(r'\b{}\b'.format(word) for word in keywords)
rx = re.compile(words_flat)
string = "there is a IO competition coming in Summer 2018"
match = rx.search(string)
if match:
print("Found: {}".format(match.group(0)))
else:
print("Not found")
Here, your list is joined with | and \b on both sides.
Afterwards, you may search with re.search() which prints "Found: IO" in this example.
Even shorter with a direct comprehension:
rx = re.compile("|".join(r'\b{}\b'.format(word) for word in keywords))
Non-regex solution
Please note that you can even use a non-regex solution for single words, you just have to reorder your comprehension and use split() like
found = any(word in keywords for word in string.split())
if found:
# do sth. here
Notes
The latter has the drawback that strings like
there is a IO. competition coming in Summer 2018
# ---^---
won't work while they do count as a "word" in the regex solution (hence the approaches are yielding different results). Additionally, because of the split() function, combined phrases like CPI Combos cannot be found. The regex solution has the advantage to even support lower and uppercase scenarios (just apply flag = re.IGNORECASE).
It really depends on your actual requirements.
for index,key in enumerate(mylist):
if key.find(mystring) != -1:
return index
It loops over your list, on every item in the list, it checks if your string is contained in the item, if it does, find() returns -1 which means it is contained, and if that happens, you get the index of the item where it was found with the help of enumerate().
I want a regular expression (in Python) that given a sentence like:
heyy how are youuuuu, it's so cool here, cooool.
converts it to:
heyy how are youu, it's so cool here, cool.
which means maximum of 1 time a character can be repeated and if it's more than that it should be removed.
heyy ==> heyy
youuuu ==> youu
cooool ==> cool
You can use back reference in the pattern to match repeated characters and then replace it with two instances of the matched character, here (.)\1+ will match a pattern that contains the same character two or more times, replace it with only two instances by \1\1:
import re
re.sub(r"(.)\1+", r"\1\1", s)
# "heyy how are youu, it's so cool here, cool."
create a new empty text and only add to it if there aren't 3 consecutive
text = "heyy how are youuuuu, it's so cool here, cooool."
new_text = ''
for i in range(len(text)):
try:
if text[i]==text[i+1]==text[i+2]:
pass
else:
new_text+=text[i]
except:
new_text+=text[i]
print new_text
>>>heyy how are youu, it's so cool here, cool.
eta: hmmm just noticed you requested "regular expressions" so approved answer is better; though this works
I want to use a regex to find a substring, followed by a variable number of characters, followed by any of several substrings.
an re.findall of
"ATGTCAGGTAAGCTTAGGGCTTTAGGATT"
should give me:
['ATGTCAGGTAA', 'ATGTCAGGTAAGCTTAG', 'ATGTCAGGTAAGCTTAGGGCTTTAG']
I have tried all of the following without success:
import re
string2 = "ATGTCAGGTAAGCTTAGGGCTTTAGGATT"
re.findall('(ATG.*TAA)|(ATG.*TAG)', string2)
re.findall('ATG.*(TAA|TAG)', string2)
re.findall('ATG.*((TAA)|(TAG))', string2)
re.findall('ATG.*(TAA)|(TAG)', string2)
re.findall('ATG.*(TAA)|ATG.*(TAG)', string2)
re.findall('(ATG.*)(TAA)|(ATG.*)(TAG)', string2)
re.findall('(ATG.*)TAA|(ATG.*)TAG', string2)
What am I missing here?
This is not super-easy, because a) you want overlapping matches, and b) you want greedy and non-greedy and everything inbetween.
As long as the strings are fairly short, you can check every substring:
import re
s = "ATGTCAGGTAAGCTTAGGGCTTTAGGATT"
p = re.compile(r'ATG.*TA[GA]$')
for start in range(len(s)-6): # string is at least 6 letters long
for end in range(start+6, len(s)):
if p.match(s, pos=start, endpos=end):
print(s[start:end])
This prints:
ATGTCAGGTAA
ATGTCAGGTAAGCTTAG
ATGTCAGGTAAGCTTAGGGCTTTAG
Since you appear to work with DNA sequences or something like that, make sure to check out Biopython, too.
I like the accepted answer just fine :-) That is, I'm adding this for info, not looking for points.
If you have heavy need for this, trying a match on O(N^2) pairs of indices may soon become unbearably slow. One improvement is to use the .search() method to "leap" directly to the only starting indices that can possibly pay off. So the following does that.
It also uses the .fullmatch() method so that you don't have to artificially change the "natural" regexp (e.g., in your example, no need to add a trailing $ to the regexp - and, indeed, in the following code doing so would no longer work as intended). Note that .fullmatch() was added in Python 3.4, so this code also requires Python 3!
Finally, this intends to generalize the re module's finditer() function/method. While you don't need match objects (you just want strings), they're far more generally applicable, and returning a generator is often friendlier than returning a list too.
So, no, this doesn't do exactly what you want, but does things from which you can get what you want, in Python 3, faster:
def finditer_overlap(regexp, string):
start = 0
n = len(string)
while start <= n:
# don't know whether regexp will find shortest or
# longest match, but _will_ find leftmost match
m = regexp.search(string, start)
if m is None:
return
start = m.start()
for finish in range(start, n+1):
m = regexp.fullmatch(string, start, finish)
if m is not None:
yield m
start += 1
Then, e.g.,
import re
string2 = "ATGTCAGGTAAGCTTAGGGCTTTAGGATT"
pat = re.compile("ATG.*(TAA|TAG)")
for match in finditer_overlap(pat, string2):
print(match.group())
prints what you wanted in your example. The other ways you tried to write a regexp should also work. In this example it's faster because the second time around the outer loop start is 1, and regexp.search(string, 1) fails to find another match, so the generator exits at once (so skips checking O(N^2) other index pairs).
I need to do some OCR on a large chunk of text and check if it contains a certain string but due to the inaccuracy of the OCR I need it to check if it contains something like a ~85% match for the string.
For example I may OCR a chunk of text to make sure it doesn't contain no information available but the OCR might see n0 inf0rmation available or misinterpret an number of characters.
Is there an easy way to do this in Python?
As posted by gauden, SequenceMatcher in difflib is an easy way to go. Using ratio(), returns a value between 0 and 1 corresponding to the similarity between the two strings, from the docs:
Where T is the total number of elements in both sequences, and M is
the number of matches, this is 2.0*M / T. Note that this is 1.0 if the
sequences are identical, and 0.0 if they have nothing in common.
example:
>>> import difflib
>>> difflib.SequenceMatcher(None,'no information available','n0 inf0rmation available').ratio()
0.91666666666666663
There is also get_close_matches, which might be useful to you, you can specify a distance cutoff and it'll return all matches within that distance from a list:
>>> difflib.get_close_matches('unicorn', ['unicycle', 'uncorn', 'corny',
'house'], cutoff=0.8)
['uncorn']
>>> difflib.get_close_matches('unicorn', ['unicycle' 'uncorn', 'corny',
'house'], cutoff=0.5)
['uncorn', 'corny', 'unicycle']
Update: to find a partial sub-sequence match
To find close matches to a three word sequence, I would split the text into words, then group them into three word sequences, then apply difflib.get_close_matches, like this:
import difflib
text = "Here is the text we are trying to match across to find the three word
sequence n0 inf0rmation available I wonder if we will find it?"
words = text.split()
three = [' '.join([i,j,k]) for i,j,k in zip(words, words[1:], words[2:])]
print difflib.get_close_matches('no information available', three, cutoff=0.9)
#Oyutput:
['n0 inf0rmation available']
The SequenceMatcher object in the difflib standard library module will give you a ratio directly:
You could compute the Levenshtein distance. Here is one Python implementation: http://pypi.python.org/pypi/python-Levenshtein/
I don't know of any available python lib that would do that out of the box, but you might find one (or find a C or C++ lib and write a Python wrapper for it).
You can also try to roll your own solution, based either on a "brute force" char by char comparison, with rules defining "proximity" between two given chars and computing the "accuracy" based on these rules (ie "o" => "0" : 90% accuracy, "o" => "w" : 1% accuracy, etc), or playing with more involved IA stuff (if you're not familiar with IA, the "Programming Collective Intelligence" book could get you started, despite the somewhat poor implementation examples).
Just to expand on fraxel's answer, this allows the finding of any arbitrary length string. Sorry for the poor formatting, SO is hard. The accuracy is the cutoff value in findWords
def joinAllInTupleList(toupe):
#joinAllInTuple( [("hello", "world"),("face","book")]) = ['hello world', 'face book']
result=[]
for i in toupe:
#i is the tuple itself
carry = " "
for z in i:
#z is an element of i
carry+=" "+z
result.append(carry.strip())
return result
def findWords(text,wordSequence):
#setup
words = text.split(" ")
#get a list of subLists based on the length of wordSequence
#i.e. get all wordSequence length sub-sequences in text!
result=[]
numberOfWordsInSequence = len(wordSequence.strip().split(" "))
for i in range(numberOfWordsInSequence):
result.append(words[i:])
# print 'result',result
c=zip(*result)
# print 'c',c
#join each tuple to a string
joined = joinAllInTupleList(c)
return difflib.get_close_matches(wordSequence, joined, cutoff=0.72389)
This is not a homework question, it is an exam preparation question.
I should define a function syllables(word) that counts the number of syllables in
A word in the following way:
• a maximal sequence of vowels is a syllable;
• a final e in a word is not a syllable (or the vowel sequence it is a part
Of).
I do not have to deal with any special cases, such as a final e in a
One-syllable word (e.g., ’be’ or ’bee’).
>>> syllables(’honour’)
2
>>> syllables(’decode’)
2
>>> syllables(’oiseau’)
2
Should I use regular expression here or just list comprehension ?
I find regular expressions natural for this question. (I think a non-regex answer would take more coding. I use two string methods, 'lower' and 'endswith' to make the answer more clear.)
import re
def syllables(word):
word = word.lower()
if word.endswith('e'):
word = word[:-1]
count = len(re.findall('[aeiou]+', word))
return count
for word in ('honour', 'decode', 'decodes', 'oiseau', 'pie'):
print word, syllables(word)
Which prints:
honour 2
decode 2
decodes 3
oiseau 2
pie 1
Note that 'decodes' has one more syllable than 'decode' (which is strange, but fits your definition).
Question. How does this help you? Isn't the point of the study question that you work through it yourself? You may get more benefit in the future by posting a failed attempt in your question, so you can learn exactly where you are lacking.
Use regexps - most languages will let you count the number of matches of a regexp in a string.
Then special-case the terminal-e by checking the right-most match group.
I don't think regex is the right solution here.
It seems pretty straightforward to write this treating each string as a list.
Some pointers:
[abc] matches a, b or c.
A + after a regex token allows the token to match once or more
$ matches the end of the string.
(?<=x) matches the current position only if the previous character is an x.
(?!x) matches the current position only if the next character is not an x.
EDIT:
I just saw your comment that since this is not homework, actual code is requested.
Well, then:
[aeiou]+(?!(?<=e)$)
If you don't want to count final vowel sequences that end in e at all (like the u in tongue or the o in toe), then use
[aeiou]+(?=[^aeiou])|[aeiou]*[aiou]$
I'm sure you'll be able to figure out how it works if you read the explanation above.
Here's an answer without regular expressions. My real answer (also posted) uses regular expressions. Untested code:
def syllables(word):
word = word.lower()
if word.endswith('e'):
word = word[:-1]
vowels = 'aeiou'
in_vowel_group = False
vowel_groups = 0
for letter in word:
if letter in vowels:
if not in_vowel_group:
in_vowel_group = True
vowel_groups += 1
else:
in_vowel_group = False
return vowel_groups
Both ways work. You said yourself that it was for exam preparation. Use whichever is going to be on the exam. If they're both on the exam, use which you need more practice for. Just remember:
Some people, when confronted with a problem, think "I know, I'll use regular expressions." Now they have two problems. ~Jamie Zawinski
So in my opinion, don't use regex unless you need the practice.
Regular expressions would be way too complex, and a list comprehension probably wouldn't be robust enough. You will probably be able to solve this easily using a grammar lexer like PyParsing. Give it a shot!
Use a regex that matches a,e,i,o, or u, convert the string to a list, then iterate through the list... 1 for first true, 1 for next false, 2 for next true, 2 for next false, etc.
To handle the case where the last letter is 'e' following a consonant (as in ate), just check the last two letters of the word before you start. If they match that pattern truncate the final e and process as normal.
This pattern works for your definition:
(?!e$)([aeiouy]+)
Just count how many times it occurs.