We Keep Coding

Using a for loop to add a new line to a table: python

I am trying to create a .bed file after searching through DNA sequences for two regular expressions. Ideally, I'd like to generate a tab-separated file which contains the sequence description, the start location of the first regex and the end location of the second regex. I know that the regex section works, it's just creating the \t separated file I am struggling with.
I was hoping that I could open/create a file and simply print a new line for each iteration of the for loop that contains this information, like so:
with open("Mimp_hits.bed", "a+") as file_object:
for line in file_object:
print(f'{sequence.description}\t{h.start()}\t{h_rc.end()}')
file_object.close()
But this doesn't seem to work (creates empty file). I have also tried to use file_object.write, but again this creates an empty file too.
This is all of the code I have including searching for the regexes:
import re, sys
from Bio import SeqIO
from Bio.SeqRecord import SeqRecord
infile = sys.argv[1]
for sequence in SeqIO.parse(infile, "fasta"):
hit = re.finditer(r"CAGTGGG..GCAA[TA]AA", str(sequence.seq))
mimp_length = 400
for h in hit:
h_start = h.start()
hit_rc = re.finditer(r"TT[TA]TTGC..CCCACTG", str(sequence.seq))
for h_rc in hit_rc:
h_rc_end = h_rc.end()
length = h_rc_end - h_start
if length > 0:
if length < mimp_length:
with open("Mimp_hits.bed", "a+") as file_object:
for line in file_object:
print(sequence.description, h.start(), h_rc.end())
file_object.close()
This is the desired output:
Focub_II5_mimp_1__contig_1.16(656599:656809) 2 208
Focub_II5_mimp_2__contig_1.47(41315:41540) 2 223
Focub_II5_mimp_3__contig_1.65(13656:13882) 2 224
Focub_II5_mimp_4__contig_1.70(61591:61809) 2 216
This is example input:
>Focub_II5_mimp_1__contig_1.16(656599:656809)
TACAGTGGGATGCAAAAAGTATTCGCAGGTGTGTAGAGAGATTTGTTGCTCGGAAGCTAGTTAGGTGTAGCTTGTCAGGTTCTCAGTACCCTATATTACACCGAGATCAGCGGGATAATCTAGTCTCGAGTACATAAGCTAAGTTAAGCTACTAACTAGCGCAGCTGACACAACTTACACACCTGCAAATACTTTTTGCATCCCACTGTA
>Focub_II5_mimp_2__contig_1.47(41315:41540)
TACAGTGGGAGGCAATAAGTATGAATACCGGGCGTGTATTGTTTTCTGCCGCTAGCCCATTTTAACAGCTAGAGTGTGTATATTAACCTCACACATAGCTATCTCTTATACTAATTGGTTAGGGAAAACCTCTAACCAGGATTAGGAGTCAACATAGCTTGTTTTAGGCTAAGAGGTGTGTGTCAGTACACCAAAGGGTATTCATACTTATTGCCCCCCACTGTA
>Focub_II5_mimp_3__contig_1.65(13656:13882)
TACAGTGGGAGGCAATAAGTATGAATACCGGGCGTGTATTGTTTTTCTGCCGCTAGCCTATTTTAATAGTTAGAGTGTGCATATTAACCTCACACATAGCTATCTTATATACTAATCGGTTAGGGAAAACCTCTAACCAGGATTAGGAGTCAACATAGCTTCTTTTAGGCTAAGAGGTGTGTGTCAGTACACCAAAGGGTATTCATACTTATTGCCCCCCACTGTA
>Focub_II5_mimp_4__contig_1.70(61591:61809)
TACAGTGGGATGCAATAAGTTTGAATGCAGGCTGAAGTACCAGCTGTTGTAATCTAGCTCCTGTATACAACGCTTTAGCTTGATAAAGTAAGCGCTAAGCTGTATCAGGCAAAAGGCTATCCCGATTGGGGTATTGCTACGTAGGGAACTGGTCTTACCTTGGTTAGTCAGTGAATGTGTACTTGAGTTTGGATTCAAACTTATTGCATCCCACTGTA
Is anybody able to help?
Thank you :)

to write a line to a file you would do something like this:
with open("file.txt", "a") as f:
print("new line", file=f)
and if you want it tab separated you can also add sep="\t", this is why python 3 made print a function so you can use sep, end, file, and flush keyword arguments. :)
opening a file for appending means the file pointer starts at the end of the file which means that writing to it doesn't override any data (gets appended to the end of the file) and iterating over it (or otherwise reading from it) gives nothing like you already reached the end of the file.
So instead of iterating over the lines of the file you would just write the single line to it:
with open("Mimp_hits.bed", "a") as file_object:
print(sequence.description, h.start(), h_rc.end(), file=file_object)
you can also consider just opening the file near the beginning of the loop since opening it once and writing multiple times is more efficient than opening it multiple times, also the with block automatically closes the file so no need to do that explicitly.

You are trying to open the file in "a+" mode, and loop over lines from it (which will not find anything because the file is positioned at the end when you do that). In any case, if this is an output file only, then you would open it in "a" mode to append to it.
Probably you just want to open the file once for appending, and inside the with statement, do your main loop, using file_object.write(...) when you want to actually append strings to the file. Note that there is no need for file_object.close() when using this with construct.
with open("Mimp_hits.bed", "a") as file_object:
for sequence in SeqIO.parse(infile, "fasta"):
# ... etc per original code ...
if length < mimp_length:
file_object.write("{}\t{}\t{}\n".format(
sequence.description, h.start(), h_rc.end()))

Reading through a .m File and Python keeps reading a character in the .m File as a line?

I am trying to read the text within a .m file in Python and Python keeps reading a single character within the .m file as a line when I use file.readline(). I've also had issues with trying to remove certain parts of the line before adding it to a list.
I've tried adjusting where the readline is on for loops that I have set up since I have to read through multiple files in this program. No matter where I put it, the string always comes out separated by character. I'm new to Python so I'm trying my best to learn what to do.
# Example of what I did
with open('MyFile.m') as f:
for line in f:
text = f.readline()
if text.startswith('%'):
continue
else:
my_string = text.strip("=")
my_list.append(my_string)
This has only partially worked as it will still return parts of lines that I do not want and when trying to format the output by putting spaces between new lines it output like so:
Expected: "The String"
What happened: "T h e S t r i n g"

Without your input file I've had to make some guesses here
Input file:
%
The
%
String
%
Solution:
my_list = []
with open('MyFile.m') as f:
for line in f:
if not line.startswith('%'):
my_list.append(line.strip("=").strip())
print(' '.join(my_list))
The readLine() call was unnecessary as the for loop already gets you the line. The empty if was negated to only catch the part that you cared about. Without your actual input file I can't help with the '=' part. If you have any clarifications I'd be glad to help further.

As suggested by Xander, you shouldn't call readline since the for line in f does that for you.
my_list = []
with open('MyFile.m') as f:
for line in f:
line = line.strip() # lose the \n if you want to
if line.startswith('%'):
continue
else:
my_string = line.strip("=")
my_list.append(my_string)

I want to transfer data from text file to array

i'm new here and also new with programming with python
as an exercise i have to read data (lat & lon) from a txt file with many rows and convert them into shapefile with QGIS
After reading i find a way to extract data into array, as step1, but i have soem issues..
I use the following code
X=[]
Y=[]
f = open('D:/test_data/test.txt','r')
for line in f:
triplets=f.readline().split() #error
X=X.append(triplets[0])
Y=Y.append(triplets[1])
f.close()
for i in X:
print X[i]
with error:
ValueError: Mixing iteration and read methods would lose data
Propably it's a warning for losing the rest rows but i really don't want them for now.

for line in f: already iterates through the lines in the file, reading as it goes along. As such, it should be:
for line in f:
triplets = line.split()
Alternatively, you could do as below, though I recommend the method above.
with open('D:/test_data/test.txt','r') as f:
content = f.readlines()
for line in content:
triplets = line.split()
# append()
See Reading and Writing Files in python for more info.
Also, append() does what it sounds like, so you don't need assignment.
X.append(triplets[0]) # not X=X.append(triplets[0)

line already is the line. Get the triplets by
triplets = line.split()

Python removing duplicates and saving the result

I am trying to remove duplicates of 3-column tab-delimited txt file, but as long as the first two columns are duplicates, then it should be removed even if the two has different 3rd column.
from operator import itemgetter
import sys
input = sys.argv[1]
output = sys.argv[2]
#Pass any column number you want, note that indexing starts at 0
ig = itemgetter(0,1)
seen = set()
data = []
for line in input.splitlines():
key = ig(line.split())
if key not in seen:
data.append(line)
seen.add(key)
file = open(output, "w")
file.write(data)
file.close()
First, I get error
key = ig(line.split())
IndexError: list index out of range
Also, I can't see how to save the result to output.txt
People say saving to output.txt is a really basic matter. But no tutorial helped.
I tried methods that use codec, those that use with, those that use file.write(data) and all didn't help.
I could learn MatLab quite easily. The online tutorial was fantastic and a series of Googling always helped a lot.
But I can't find a helpful tutorial of Python yet. This is obviously because I am a complete novice. For complete novices like me, what would be the best tutorial with 1) comprehensiveness AND 2) lots of examples 3) line by line explanation that dosen't leave any line without explanation?
And why is the above code causing error and not saving result?

I'm assuming since you assign input to the first command line argument with input = sys.argv[1] and output to the second, you intend those to be your input and output file names. But you're never opening any file for the input data, so you're callling .splitlines() on a file name, not on file contents.
Next, splitlines() is the wrong approach here anyway. To iterate over a file line-by-line, simply use for line in f, where f is an open file. Those lines will include the newline at the end of the line, so it needs to be stripped if it's not supposed to be part of the third columns data.
Then you're opening and closing the file inside your loop, which means you'll try to write the entire contents of data to the file every iteration, effectively overwriting any data written to the file before. Therefore I moved that block out of the loop.
It's good practice to use the with statement for opening files. with open(out_fn, "w") as outfile will open the file named out_fn and assign the open file to outfile, and close it for you as soon as you exit that indented block.
input is a builtin function in Python. I therefore renamed your variables so no builtin names get shadowed.
You're trying to directly write data to the output file. This won't work since data is a list of lines. You need to join those lines first in order to turn them in a single string again before writing it to a file.
So here's your code with all those issues addressed:
from operator import itemgetter
import sys
in_fn = sys.argv[1]
out_fn = sys.argv[2]
getkey = itemgetter(0, 1)
seen = set()
data = []
with open(in_fn, 'r') as infile:
for line in infile:
line = line.strip()
key = getkey(line.split())
if key not in seen:
data.append(line)
seen.add(key)
with open(out_fn, "w") as outfile:
outfile.write('\n'.join(data))

Why is the above code causing error?
Because you haven't opened the file, you are trying to work with the string input.txtrather than with the file. Then when you try to access your item, you get a list index out of range because line.split() returns ['input.txt'].
How to fix that: open the file and then work with it, not with its name.
For example, you can do (I tried to stay as close to your code as possible)
input = sys.argv[1]
infile = open(input, 'r')
(...)
lines = infile.readlines()
infile.close()
for line in lines:
(...)
Why is this not saving result?
Because you are opening/closing the file inside the loop. What you need to do is write the data once you're out of the loop. Also, you cannot write directly a list to a file. Hence, you need to do something like (outside of your loop):
outfile = open(output, "w")
for item in data:
outfile.write(item)
outfile.close()
All together
There are other ways of reading/writing files, and it is pretty well documented on the internet but I tried to stay close to your code so that you would understand better what was wrong with it
from operator import itemgetter
import sys
input = sys.argv[1]
infile = open(input, 'r')
output = sys.argv[2]
#Pass any column number you want, note that indexing starts at 0
ig = itemgetter(0,1)
seen = set()
data = []
lines = infile.readlines()
infile.close()
for line in lines:
print line
key = ig(line.split())
if key not in seen:
data.append(line)
seen.add(key)
print data
outfile = open(output, "w")
for item in data:
outfile.write(item)
outfile.close()
PS: it seems to produce the result that you needed there Python to remove duplicates using only some, not all, columns

.txt file does not print after being written with a join lines command in python

I'm new to Python and I have the following question:
I am writing the first 72 lines of a .txt-file to another .txt-file, textA.txt.
textA = open('textA.txt', 'w')
textA.write('\n'.join(lines[1:72]))
textA.close
Now, as I intended, the textA file contains 72 sentences, each starting at a new line.
However, when I do a line count or I am trying to print the file through
f=open ('textA.txt','r')
print f.read()
nothing happens (and the nonblank lines count is zero).
Can someone help me out?

It looks like you haven't closed the file handle, and the write may not have finished. close function needs to be called :: textA.close().
To not have to worry about remembering to close files, use the with statement.
with open('textA.txt', 'w') as f:
f.write('\n'.join(lines[1:72]))
And then, read back your file, as required
with open('textA.txt') as f:
print f.readlines()